ID: 1174465207

View in Genome Browser
Species Human (GRCh38)
Location 20:50712022-50712044
Sequence GATCCTCCTTCCAAAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174465201_1174465207 22 Left 1174465201 20:50711977-50711999 CCTCCATATGCTACCCAGGCTGG No data
Right 1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG No data
1174465205_1174465207 8 Left 1174465205 20:50711991-50712013 CCAGGCTGGTCTCGAACTCTTGA 0: 2169
1: 59941
2: 172259
3: 233127
4: 172084
Right 1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG No data
1174465203_1174465207 19 Left 1174465203 20:50711980-50712002 CCATATGCTACCCAGGCTGGTCT 0: 8
1: 206
2: 2764
3: 5442
4: 8047
Right 1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG No data
1174465204_1174465207 9 Left 1174465204 20:50711990-50712012 CCCAGGCTGGTCTCGAACTCTTG 0: 520
1: 12914
2: 57883
3: 67224
4: 46710
Right 1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174465207 Original CRISPR GATCCTCCTTCCAAAGTGTT GGG Intergenic
No off target data available for this crispr