ID: 1174467784

View in Genome Browser
Species Human (GRCh38)
Location 20:50731103-50731125
Sequence AGGCACGCGGGGAGGCCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467784_1174467798 19 Left 1174467784 20:50731103-50731125 CCGGCCGGCCTCCCCGCGTGCCT No data
Right 1174467798 20:50731145-50731167 GCACCCGCGCATGCGCCTTCTGG No data
1174467784_1174467801 27 Left 1174467784 20:50731103-50731125 CCGGCCGGCCTCCCCGCGTGCCT No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467784 Original CRISPR AGGCACGCGGGGAGGCCGGC CGG (reversed) Intergenic