ID: 1174467788

View in Genome Browser
Species Human (GRCh38)
Location 20:50731111-50731133
Sequence CCCCGGGAAGGCACGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467788_1174467801 19 Left 1174467788 20:50731111-50731133 CCTCCCCGCGTGCCTTCCCGGGG No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467788_1174467798 11 Left 1174467788 20:50731111-50731133 CCTCCCCGCGTGCCTTCCCGGGG No data
Right 1174467798 20:50731145-50731167 GCACCCGCGCATGCGCCTTCTGG No data
1174467788_1174467803 29 Left 1174467788 20:50731111-50731133 CCTCCCCGCGTGCCTTCCCGGGG No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467788_1174467804 30 Left 1174467788 20:50731111-50731133 CCTCCCCGCGTGCCTTCCCGGGG No data
Right 1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467788 Original CRISPR CCCCGGGAAGGCACGCGGGG AGG (reversed) Intergenic