ID: 1174467790

View in Genome Browser
Species Human (GRCh38)
Location 20:50731114-50731136
Sequence CCGCCCCGGGAAGGCACGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467790_1174467798 8 Left 1174467790 20:50731114-50731136 CCCCGCGTGCCTTCCCGGGGCGG No data
Right 1174467798 20:50731145-50731167 GCACCCGCGCATGCGCCTTCTGG No data
1174467790_1174467803 26 Left 1174467790 20:50731114-50731136 CCCCGCGTGCCTTCCCGGGGCGG No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467790_1174467804 27 Left 1174467790 20:50731114-50731136 CCCCGCGTGCCTTCCCGGGGCGG No data
Right 1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG No data
1174467790_1174467801 16 Left 1174467790 20:50731114-50731136 CCCCGCGTGCCTTCCCGGGGCGG No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467790_1174467805 28 Left 1174467790 20:50731114-50731136 CCCCGCGTGCCTTCCCGGGGCGG No data
Right 1174467805 20:50731165-50731187 TGGCTCTCCGGCCTGAAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467790 Original CRISPR CCGCCCCGGGAAGGCACGCG GGG (reversed) Intergenic
No off target data available for this crispr