ID: 1174467792

View in Genome Browser
Species Human (GRCh38)
Location 20:50731115-50731137
Sequence TCCGCCCCGGGAAGGCACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467792_1174467801 15 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467792_1174467805 27 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467805 20:50731165-50731187 TGGCTCTCCGGCCTGAAGCGGGG No data
1174467792_1174467798 7 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467798 20:50731145-50731167 GCACCCGCGCATGCGCCTTCTGG No data
1174467792_1174467806 30 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467792_1174467804 26 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG No data
1174467792_1174467803 25 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467792 Original CRISPR TCCGCCCCGGGAAGGCACGC GGG (reversed) Intergenic