ID: 1174467793

View in Genome Browser
Species Human (GRCh38)
Location 20:50731116-50731138
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467793_1174467804 25 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG No data
1174467793_1174467801 14 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467793_1174467805 26 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467805 20:50731165-50731187 TGGCTCTCCGGCCTGAAGCGGGG No data
1174467793_1174467803 24 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467793_1174467806 29 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467793_1174467798 6 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467798 20:50731145-50731167 GCACCCGCGCATGCGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467793 Original CRISPR TTCCGCCCCGGGAAGGCACG CGG (reversed) Intergenic