ID: 1174467795

View in Genome Browser
Species Human (GRCh38)
Location 20:50731127-50731149
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467795_1174467805 15 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467805 20:50731165-50731187 TGGCTCTCCGGCCTGAAGCGGGG No data
1174467795_1174467801 3 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467795_1174467804 14 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG No data
1174467795_1174467806 18 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467795_1174467798 -5 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467798 20:50731145-50731167 GCACCCGCGCATGCGCCTTCTGG No data
1174467795_1174467807 21 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467807 20:50731171-50731193 TCCGGCCTGAAGCGGGGCGGAGG No data
1174467795_1174467809 22 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467795_1174467803 13 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467795_1174467811 28 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467795 Original CRISPR GGTGCTGGAGTTTCCGCCCC GGG (reversed) Intergenic