ID: 1174467797

View in Genome Browser
Species Human (GRCh38)
Location 20:50731142-50731164
Sequence GAAGGCGCATGCGCGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467797_1174467809 7 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467797_1174467807 6 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467807 20:50731171-50731193 TCCGGCCTGAAGCGGGGCGGAGG No data
1174467797_1174467804 -1 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG No data
1174467797_1174467805 0 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467805 20:50731165-50731187 TGGCTCTCCGGCCTGAAGCGGGG No data
1174467797_1174467803 -2 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467797_1174467811 13 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data
1174467797_1174467812 20 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467812 20:50731185-50731207 GGGCGGAGGGCCATGGCTTCAGG No data
1174467797_1174467806 3 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467797 Original CRISPR GAAGGCGCATGCGCGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr