ID: 1174467800

View in Genome Browser
Species Human (GRCh38)
Location 20:50731149-50731171
Sequence AGAGCCAGAAGGCGCATGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467800_1174467812 13 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467812 20:50731185-50731207 GGGCGGAGGGCCATGGCTTCAGG No data
1174467800_1174467807 -1 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467807 20:50731171-50731193 TCCGGCCTGAAGCGGGGCGGAGG No data
1174467800_1174467805 -7 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467805 20:50731165-50731187 TGGCTCTCCGGCCTGAAGCGGGG No data
1174467800_1174467811 6 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data
1174467800_1174467804 -8 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467804 20:50731164-50731186 CTGGCTCTCCGGCCTGAAGCGGG No data
1174467800_1174467809 0 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467800_1174467806 -4 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467800_1174467803 -9 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467800 Original CRISPR AGAGCCAGAAGGCGCATGCG CGG (reversed) Intergenic