ID: 1174467801

View in Genome Browser
Species Human (GRCh38)
Location 20:50731153-50731175
Sequence GCATGCGCCTTCTGGCTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467785_1174467801 23 Left 1174467785 20:50731107-50731129 CCGGCCTCCCCGCGTGCCTTCCC No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467788_1174467801 19 Left 1174467788 20:50731111-50731133 CCTCCCCGCGTGCCTTCCCGGGG No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467793_1174467801 14 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467792_1174467801 15 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467796_1174467801 2 Left 1174467796 20:50731128-50731150 CCGGGGCGGAAACTCCAGCACCC No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467784_1174467801 27 Left 1174467784 20:50731103-50731125 CCGGCCGGCCTCCCCGCGTGCCT No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467794_1174467801 7 Left 1174467794 20:50731123-50731145 CCTTCCCGGGGCGGAAACTCCAG No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467790_1174467801 16 Left 1174467790 20:50731114-50731136 CCCCGCGTGCCTTCCCGGGGCGG No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data
1174467795_1174467801 3 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467801 20:50731153-50731175 GCATGCGCCTTCTGGCTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467801 Original CRISPR GCATGCGCCTTCTGGCTCTC CGG Intergenic