ID: 1174467803

View in Genome Browser
Species Human (GRCh38)
Location 20:50731163-50731185
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467793_1174467803 24 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467797_1174467803 -2 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467795_1174467803 13 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467800_1174467803 -9 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467790_1174467803 26 Left 1174467790 20:50731114-50731136 CCCCGCGTGCCTTCCCGGGGCGG No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467799_1174467803 -8 Left 1174467799 20:50731148-50731170 CCCGCGCATGCGCCTTCTGGCTC No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467796_1174467803 12 Left 1174467796 20:50731128-50731150 CCGGGGCGGAAACTCCAGCACCC No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467788_1174467803 29 Left 1174467788 20:50731111-50731133 CCTCCCCGCGTGCCTTCCCGGGG No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467794_1174467803 17 Left 1174467794 20:50731123-50731145 CCTTCCCGGGGCGGAAACTCCAG No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data
1174467792_1174467803 25 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467803 20:50731163-50731185 TCTGGCTCTCCGGCCTGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467803 Original CRISPR TCTGGCTCTCCGGCCTGAAG CGG Intergenic
No off target data available for this crispr