ID: 1174467806

View in Genome Browser
Species Human (GRCh38)
Location 20:50731168-50731190
Sequence CTCTCCGGCCTGAAGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467797_1174467806 3 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467796_1174467806 17 Left 1174467796 20:50731128-50731150 CCGGGGCGGAAACTCCAGCACCC No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467800_1174467806 -4 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467792_1174467806 30 Left 1174467792 20:50731115-50731137 CCCGCGTGCCTTCCCGGGGCGGA No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467793_1174467806 29 Left 1174467793 20:50731116-50731138 CCGCGTGCCTTCCCGGGGCGGAA No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467795_1174467806 18 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467794_1174467806 22 Left 1174467794 20:50731123-50731145 CCTTCCCGGGGCGGAAACTCCAG No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data
1174467799_1174467806 -3 Left 1174467799 20:50731148-50731170 CCCGCGCATGCGCCTTCTGGCTC No data
Right 1174467806 20:50731168-50731190 CTCTCCGGCCTGAAGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467806 Original CRISPR CTCTCCGGCCTGAAGCGGGG CGG Intergenic