ID: 1174467809

View in Genome Browser
Species Human (GRCh38)
Location 20:50731172-50731194
Sequence CCGGCCTGAAGCGGGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467800_1174467809 0 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467795_1174467809 22 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467794_1174467809 26 Left 1174467794 20:50731123-50731145 CCTTCCCGGGGCGGAAACTCCAG No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467796_1174467809 21 Left 1174467796 20:50731128-50731150 CCGGGGCGGAAACTCCAGCACCC No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467797_1174467809 7 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
1174467799_1174467809 1 Left 1174467799 20:50731148-50731170 CCCGCGCATGCGCCTTCTGGCTC No data
Right 1174467809 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467809 Original CRISPR CCGGCCTGAAGCGGGGCGGA GGG Intergenic
No off target data available for this crispr