ID: 1174467811

View in Genome Browser
Species Human (GRCh38)
Location 20:50731178-50731200
Sequence TGAAGCGGGGCGGAGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467800_1174467811 6 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data
1174467802_1174467811 -5 Left 1174467802 20:50731160-50731182 CCTTCTGGCTCTCCGGCCTGAAG No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data
1174467799_1174467811 7 Left 1174467799 20:50731148-50731170 CCCGCGCATGCGCCTTCTGGCTC No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data
1174467797_1174467811 13 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data
1174467796_1174467811 27 Left 1174467796 20:50731128-50731150 CCGGGGCGGAAACTCCAGCACCC No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data
1174467795_1174467811 28 Left 1174467795 20:50731127-50731149 CCCGGGGCGGAAACTCCAGCACC No data
Right 1174467811 20:50731178-50731200 TGAAGCGGGGCGGAGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467811 Original CRISPR TGAAGCGGGGCGGAGGGCCA TGG Intergenic
No off target data available for this crispr