ID: 1174467812

View in Genome Browser
Species Human (GRCh38)
Location 20:50731185-50731207
Sequence GGGCGGAGGGCCATGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174467802_1174467812 2 Left 1174467802 20:50731160-50731182 CCTTCTGGCTCTCCGGCCTGAAG No data
Right 1174467812 20:50731185-50731207 GGGCGGAGGGCCATGGCTTCAGG No data
1174467808_1174467812 -10 Left 1174467808 20:50731172-50731194 CCGGCCTGAAGCGGGGCGGAGGG No data
Right 1174467812 20:50731185-50731207 GGGCGGAGGGCCATGGCTTCAGG No data
1174467799_1174467812 14 Left 1174467799 20:50731148-50731170 CCCGCGCATGCGCCTTCTGGCTC No data
Right 1174467812 20:50731185-50731207 GGGCGGAGGGCCATGGCTTCAGG No data
1174467797_1174467812 20 Left 1174467797 20:50731142-50731164 CCAGCACCCGCGCATGCGCCTTC No data
Right 1174467812 20:50731185-50731207 GGGCGGAGGGCCATGGCTTCAGG No data
1174467800_1174467812 13 Left 1174467800 20:50731149-50731171 CCGCGCATGCGCCTTCTGGCTCT No data
Right 1174467812 20:50731185-50731207 GGGCGGAGGGCCATGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174467812 Original CRISPR GGGCGGAGGGCCATGGCTTC AGG Intergenic
No off target data available for this crispr