ID: 1174468945

View in Genome Browser
Species Human (GRCh38)
Location 20:50741205-50741227
Sequence GAACACTTCGAGGCCAAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 826}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174468945 Original CRISPR GAACACTTCGAGGCCAAGAC GGG (reversed) Intronic
900144867 1:1153844-1153866 CAGCACTGGGAGGCCAAGACTGG - Intergenic
901222879 1:7593793-7593815 TAACACTAGGAGGCCAAGGCAGG + Intronic
901502947 1:9664954-9664976 GCACACTGGGAGGCCAAGATGGG + Intronic
901802438 1:11716113-11716135 GAACTTTGGGAGGCCAAGACAGG - Intronic
902333495 1:15742390-15742412 TAACCCTTCGAGGCCCAGAAGGG - Intergenic
902450576 1:16494361-16494383 CAACACTGGGAGGCCAAGGCAGG + Intergenic
902471929 1:16654211-16654233 GCACATTGGGAGGCCAAGACAGG - Intergenic
902593446 1:17491563-17491585 GCACTCTGGGAGGCCAAGACGGG - Intergenic
902877725 1:19350862-19350884 CAACACTGGGAGGCCAAGGCAGG - Intronic
903579511 1:24360196-24360218 GCACTCTGGGAGGCCAAGACGGG + Intronic
905084029 1:35353896-35353918 GAACTTTGGGAGGCCAAGACAGG + Intronic
905107404 1:35572733-35572755 GAAAACTTCCAAGCCAAGCCAGG - Intergenic
905189418 1:36222144-36222166 CAACACTGGGAGGCCAAGGCGGG - Intergenic
905204200 1:36333643-36333665 GAACACTTCTAGGGGAGGACTGG + Intergenic
905578082 1:39062055-39062077 GCACACTGGGAGGCCAAGGCAGG - Intergenic
905842200 1:41191119-41191141 GAACTTTGGGAGGCCAAGACAGG - Intronic
906054475 1:42904327-42904349 GAAAACTTCTAGGCCTAAACAGG - Intergenic
906412812 1:45592759-45592781 GCACTCTGGGAGGCCAAGACGGG - Intronic
906489200 1:46254831-46254853 GCACTCTGGGAGGCCAAGACAGG - Intronic
907773359 1:57488155-57488177 GAACTTTGGGAGGCCAAGACGGG + Intronic
907851794 1:58261801-58261823 GCACTCTGGGAGGCCAAGACAGG - Intronic
908277904 1:62495343-62495365 GAACTTTGGGAGGCCAAGACAGG + Intronic
908439030 1:64134993-64135015 GCACACTGGGAGGCCGAGACGGG - Intronic
908551641 1:65214355-65214377 GCACTCTGGGAGGCCAAGACGGG - Intronic
908734139 1:67257948-67257970 CAGCACTTTGAGGCCAAGGCAGG - Intronic
908861206 1:68492001-68492023 GCACTTTTGGAGGCCAAGACAGG - Intronic
909986674 1:82169664-82169686 CAACACTGGGAGGCCAAGGCAGG - Intergenic
910269825 1:85382002-85382024 GAACACTTGGAGGCCATGGTAGG - Intronic
910530890 1:88234290-88234312 AAACACCTCAAGGCCAAGATTGG + Intergenic
910828243 1:91432124-91432146 CAACACTGGGAGGCCAAGGCAGG + Intergenic
910873207 1:91853765-91853787 GAACTTTTGGAGGCCAAGGCGGG + Intronic
910984172 1:92989491-92989513 TAGCACTCTGAGGCCAAGACAGG - Intergenic
911190270 1:94941543-94941565 GCACACTGGGAGGCCAAGGCAGG - Intergenic
911641674 1:100296374-100296396 GCACTCTGAGAGGCCAAGACGGG - Intergenic
911649631 1:100373179-100373201 GAACACTGAGAGGCCATGATAGG + Intronic
911943673 1:104077770-104077792 GCACTTTTCGAGGCCAAGGCAGG + Intergenic
912183647 1:107248900-107248922 GAACTTTTGGAGGCCAAGACAGG + Intronic
912995151 1:114525734-114525756 GCACTTTTGGAGGCCAAGACGGG - Intergenic
913165308 1:116179490-116179512 GAACTTTGGGAGGCCAAGACAGG - Intergenic
913169136 1:116216448-116216470 GCACACTGGGAGGCCAAGGCGGG + Intergenic
913181049 1:116321849-116321871 TAACACATCTAGGCAAAGACTGG + Intergenic
914230324 1:145760189-145760211 GCACATTGGGAGGCCAAGACAGG + Intronic
914297847 1:146346740-146346762 GAACTTTTGGAGGACAAGACAGG - Intergenic
914527610 1:148485260-148485282 GAACTTTTGGAGGACAAGACAGG - Intergenic
914812597 1:151039995-151040017 GCACACTGGGAGGCCAAGGCAGG - Intronic
914862537 1:151398668-151398690 GAACTTTGGGAGGCCAAGACGGG - Intergenic
915339892 1:155171170-155171192 GCACTCTGGGAGGCCAAGACGGG + Intronic
915408771 1:155683888-155683910 GCAAACTGGGAGGCCAAGACAGG + Intronic
915562696 1:156696577-156696599 GAACTTTGGGAGGCCAAGACAGG - Intergenic
915759653 1:158297684-158297706 TAACACTTTGAGGCTAAGGCAGG + Intergenic
916047518 1:161011491-161011513 CAACACTGAGAGGCCGAGACAGG + Intronic
916505099 1:165421776-165421798 GAACTTTGGGAGGCCAAGACGGG - Intronic
916545128 1:165796888-165796910 CAACACTGGGAGGCCAAGATGGG + Intronic
916547761 1:165822605-165822627 GCACTCTTGGAGGCCAAGGCGGG + Intronic
917853454 1:179083653-179083675 GCACTCTTGGAGGCCAAGGCAGG - Intronic
917875934 1:179287078-179287100 GAACTTTTTGAGGCCAAGGCAGG + Intergenic
918455719 1:184711344-184711366 GGACACTGGGAGGCCAAGGCAGG - Intronic
918712502 1:187748736-187748758 GAACTCTGGGAGGCCAAGGCAGG - Intergenic
919312038 1:195923206-195923228 AAACCATTCGAGGCCAAGATGGG - Intergenic
919709656 1:200713056-200713078 GCACTCTGGGAGGCCAAGACAGG - Intergenic
920007046 1:202840969-202840991 CAACACTGAGAGGCCAAGGCGGG - Intergenic
920110475 1:203583743-203583765 GATCACTTCGATGCCCAGGCTGG - Intergenic
920240364 1:204543257-204543279 TAACACTGGGAGGCCGAGACAGG + Intronic
920523293 1:206645771-206645793 GAACTTTGGGAGGCCAAGACGGG - Intronic
920898235 1:210078999-210079021 CAGCACTTAGAGGCCAGGACGGG - Intronic
921313908 1:213872676-213872698 GAACACTTAGAGGCCATTGCGGG - Intergenic
921417389 1:214905816-214905838 GAACACCTAGATGCAAAGACTGG - Intergenic
921571729 1:216787626-216787648 GAACACTTGGAGGCCATTTCGGG - Intronic
922651324 1:227341528-227341550 GAACACTTAGAGGCCATTATAGG + Intergenic
922946919 1:229524407-229524429 GCACTCTGGGAGGCCAAGACAGG - Intronic
923689092 1:236175801-236175823 GAACACCTCCAGCCCTAGACAGG + Intronic
924562000 1:245164824-245164846 GAACTTTGGGAGGCCAAGACGGG + Intronic
1063501729 10:6561122-6561144 GCACTCTGGGAGGCCAAGACAGG + Intronic
1063731899 10:8707238-8707260 GATAACATTGAGGCCAAGACGGG + Intergenic
1064049257 10:12046042-12046064 CAACACTGGGAGGCCAAGGCGGG + Intergenic
1064315881 10:14255757-14255779 GCACACTGCGAGGCCGAGGCAGG + Intronic
1064591221 10:16892738-16892760 GCACTTTTGGAGGCCAAGACAGG - Intronic
1065546650 10:26828100-26828122 GAACACTTAGAGGCCAACATAGG + Intronic
1065549607 10:26857392-26857414 GCACACTGGGAGGCCAAGGCAGG + Intronic
1065591983 10:27272105-27272127 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1065607780 10:27437025-27437047 CAACACTGGGAGGCCAAGGCGGG + Intergenic
1065717782 10:28590072-28590094 GAACTTTGGGAGGCCAAGACGGG + Intronic
1066299955 10:34087759-34087781 GCACTCTTGGAGGCCAAGGCGGG - Intergenic
1067314619 10:45150258-45150280 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1068276572 10:54806728-54806750 GAATTCTTTGAGGCCAAGGCGGG - Intronic
1068488968 10:57697782-57697804 GCACTTTTGGAGGCCAAGACAGG + Intergenic
1068985100 10:63100956-63100978 CAACACTGGGAGGCCAAGGCCGG + Intergenic
1069374753 10:67782578-67782600 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1069518190 10:69096727-69096749 GCACACTGGGAGGCCAAGGCAGG + Intronic
1069940535 10:71952325-71952347 GAACACTCCCAGGGCAGGACTGG - Intergenic
1069947182 10:71995594-71995616 GAACACTTAGAGGCCATGGCAGG + Intronic
1070002535 10:72391183-72391205 CAACACTGGGAGGCCAAGGCGGG + Intronic
1070163076 10:73877540-73877562 GCACTTTTGGAGGCCAAGACAGG - Intergenic
1071043395 10:81341799-81341821 GCACACTGGGAGGCCAAGGCAGG + Intergenic
1071683319 10:87729607-87729629 GAACACTTAGAGGCCATTGCAGG - Intronic
1072110430 10:92314393-92314415 CAACACTGGGAGGCCAAGGCAGG + Intronic
1073054809 10:100692468-100692490 CAACACTTTGGGGCCAAGACAGG + Intergenic
1073196633 10:101696440-101696462 GAACACTAAAAGGCCAAGATAGG - Intergenic
1073342410 10:102755637-102755659 GCACTCTGGGAGGCCAAGACAGG - Intronic
1073521130 10:104130705-104130727 GAACACTTGGAGGCCAGGTGTGG + Intronic
1073751398 10:106531495-106531517 GAACACTGGGAGGCCGAGGCGGG - Intergenic
1074103182 10:110369679-110369701 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1075133861 10:119764822-119764844 GCACTTTGCGAGGCCAAGACAGG - Intronic
1075350245 10:121717921-121717943 GCACACTGGGAGGCCAAGGCGGG - Intergenic
1075796078 10:125120631-125120653 GAACATTGGGAGGCCAAGGCGGG - Intronic
1076513447 10:131028597-131028619 GAACACTTCGAGGCCATGGTAGG - Intergenic
1077578700 11:3403291-3403313 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1078116041 11:8451954-8451976 CAACACTGGGAGGCCAAGGCAGG + Intronic
1078198054 11:9153073-9153095 CAACACTGGGAGGCCAAGGCGGG + Intronic
1079169223 11:18076232-18076254 GCCCACTGAGAGGCCAAGACAGG + Intronic
1079706490 11:23627016-23627038 CAGCACTTGGAGGCCAAGGCGGG + Intergenic
1080168741 11:29272713-29272735 GCACATTGCGAGGCCAAGCCGGG - Intergenic
1080842317 11:35996214-35996236 GAACACTTAGAGGCCATGGTAGG + Intronic
1081375290 11:42351287-42351309 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1081996496 11:47368117-47368139 GCACTTTGCGAGGCCAAGACGGG + Intronic
1082053614 11:47794245-47794267 GCACTCTGGGAGGCCAAGACGGG + Intronic
1082155684 11:48808077-48808099 GAACACTTTGAGGCCTACAGTGG + Intergenic
1082262174 11:50084893-50084915 CAACACTGGGAGGTCAAGACAGG + Intergenic
1082315399 11:50712036-50712058 GAACGCTTTGAGGCCAATAGTGG - Intergenic
1082607079 11:55252005-55252027 GAACACTTTGAGGCCTACAGTGG - Intergenic
1083392649 11:62366011-62366033 GAACTTTGGGAGGCCAAGACAGG + Intronic
1083395006 11:62384667-62384689 GAACTTTGGGAGGCCAAGACAGG + Intronic
1083786471 11:64951516-64951538 GCACTCTGCGAGGCCAAGGCAGG + Intronic
1084235730 11:67786805-67786827 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1084548716 11:69827996-69828018 CAACACTCTGAGGCCAAGACAGG - Intergenic
1084824192 11:71717066-71717088 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1084977145 11:72807782-72807804 GCACACTGGGAGGCCAAGGCGGG - Intergenic
1085028627 11:73256160-73256182 CAGCACTTAGAGGCCAAGGCAGG - Intergenic
1085090038 11:73704133-73704155 GAAATCTTCGAGGCCAAGTTGGG + Intronic
1085372976 11:76028354-76028376 GAACACTTAGAGGCCATTATAGG - Intronic
1086109778 11:83187302-83187324 GCACTCTGGGAGGCCAAGACGGG - Exonic
1086283820 11:85222210-85222232 GAACTTTGGGAGGCCAAGACAGG - Intronic
1087286539 11:96270553-96270575 GCACTTTTGGAGGCCAAGACAGG - Intronic
1087494612 11:98874609-98874631 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1087517129 11:99178232-99178254 GCACATTTGGAGGCCAAGGCAGG + Intronic
1087553267 11:99679685-99679707 GAACACTTAGAGGCCACGGTAGG - Intronic
1087913943 11:103786320-103786342 GAACACTTAGAGGCCATCATAGG + Intergenic
1088271120 11:108035488-108035510 GAACTTTGGGAGGCCAAGACAGG + Intronic
1088271988 11:108043318-108043340 GCACTCTTGGAGGCCAAGGCAGG - Intronic
1088327482 11:108615987-108616009 GCACTTTTGGAGGCCAAGACAGG + Intergenic
1088439685 11:109856004-109856026 GAACACTTAGAGGCCAATGTAGG + Intergenic
1088480488 11:110292044-110292066 GCACACTGGGAGGCCAAGGCGGG + Intronic
1088635541 11:111816805-111816827 GAACTTTTGGAGGCCAAGGCGGG - Intronic
1088866534 11:113853054-113853076 GCACACTGGGAGGCCAAGGCGGG + Intronic
1088875662 11:113934138-113934160 GAACTCTGGGAGGCCAAGGCAGG + Intronic
1089227277 11:116936026-116936048 GCACACTGGGAGGCCAAGAAGGG + Intronic
1089530484 11:119125283-119125305 GCACTCTGGGAGGCCAAGACAGG - Intronic
1090240420 11:125177610-125177632 GAACCCTCTGAGGCCAGGACTGG - Intronic
1091481417 12:835704-835726 GAACTTTGGGAGGCCAAGACTGG + Intronic
1091499263 12:999839-999861 GCACTCTGGGAGGCCAAGACAGG - Intronic
1091950142 12:4585965-4585987 CAACACTGGGAGGCCAAGGCAGG + Intronic
1091987922 12:4928172-4928194 GCACTTTTGGAGGCCAAGACAGG + Intronic
1092040038 12:5375975-5375997 GCACACTGGGAGGCCAAGGCCGG + Intergenic
1092267292 12:6991943-6991965 GCACTCTGGGAGGCCAAGACGGG + Intronic
1092357881 12:7811700-7811722 GAACTTTGCGAGGCCAAGACGGG - Intergenic
1092505742 12:9097877-9097899 CAACACTGGGAGGCCAAGGCAGG - Intronic
1092676056 12:10922014-10922036 GAACATTGGGAGGTCAAGACAGG - Intronic
1092893378 12:12990422-12990444 CAACACTGGGAAGCCAAGACAGG - Intronic
1092919122 12:13214941-13214963 GAACAGCTGGAGGCCAAGTCTGG - Exonic
1093568133 12:20633195-20633217 GCACTTTTCGAGGCCAAGGCAGG - Intronic
1093683456 12:22030022-22030044 CAACACTTGGAGGCCAAGGCAGG + Intergenic
1094129318 12:27058426-27058448 GCACTTTTGGAGGCCAAGACAGG + Intronic
1095063015 12:37725291-37725313 GAACACTTTGAGGCCAATGGTGG + Intergenic
1095132843 12:38564344-38564366 AGAGACTTCTAGGCCAAGACTGG + Intergenic
1095444307 12:42268898-42268920 GCACATTGGGAGGCCAAGACAGG - Intronic
1095744621 12:45643805-45643827 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1095910562 12:47422337-47422359 GAACACTTAGAGGCCAATGTGGG - Intergenic
1095995800 12:48083149-48083171 GCACAGTGGGAGGCCAAGACAGG - Intronic
1096140970 12:49242235-49242257 GAACTTTGGGAGGCCAAGACAGG - Intronic
1096221837 12:49834841-49834863 CAACACTGAGAGGCCAAGGCAGG - Intergenic
1096336589 12:50761500-50761522 CAGCAGTTCGAGACCAAGACTGG + Intergenic
1096434931 12:51581470-51581492 GAACACTTAGAGGCCACTATAGG - Intergenic
1096444536 12:51677332-51677354 GCACTCTTGGAGGCCAAGAAGGG - Intronic
1096883458 12:54692976-54692998 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1097064718 12:56312466-56312488 GCACTCTTGGAGGCCAAGGCAGG - Intronic
1097076152 12:56396325-56396347 GCACTTTTGGAGGCCAAGACAGG + Intergenic
1097320292 12:58218422-58218444 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1097782755 12:63727012-63727034 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1097860057 12:64509838-64509860 GAACTTTGCGAGGCCAAGGCGGG + Intergenic
1097986339 12:65786671-65786693 GAACTTTGCGAGGCCAAGATGGG - Intergenic
1098278801 12:68841341-68841363 GCACTTTGCGAGGCCAAGACAGG - Exonic
1098344444 12:69486536-69486558 GAACACTTAGAGGCCATCATAGG - Intronic
1098559615 12:71857194-71857216 GGACACTGGGAGGCCAAGGCAGG - Intronic
1099152187 12:79128144-79128166 GAACTTTGGGAGGCCAAGACGGG + Intronic
1099474235 12:83088519-83088541 GAACACTTAGAGACCAAAAGAGG + Intronic
1100257002 12:92894314-92894336 GAACACTTAGAGGCCATTATAGG - Intronic
1100949863 12:99835163-99835185 GCACTTTTGGAGGCCAAGACAGG + Intronic
1101505051 12:105338418-105338440 GCACTCTGGGAGGCCAAGACGGG - Intronic
1101617179 12:106349705-106349727 CAGCACTTCGAGGCCAAAGCAGG + Intergenic
1101805309 12:108058178-108058200 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1102138401 12:110594359-110594381 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1102139610 12:110603908-110603930 GAACTTTGGGAGGCCAAGACGGG - Intergenic
1102299623 12:111761666-111761688 CAACACTTTGAGGCCGAGGCGGG - Intronic
1102884797 12:116513330-116513352 GCACACTGGGAGGCCGAGACGGG + Intergenic
1103104829 12:118215123-118215145 GCACTTTTGGAGGCCAAGACGGG - Intronic
1103195585 12:119040969-119040991 GATCACTTGGAGTTCAAGACCGG - Intronic
1103416239 12:120743132-120743154 GAACTCTGGGAGGCCAAGGCGGG - Intergenic
1103546494 12:121705461-121705483 GCACACTGGGAGGCCAAGGCAGG - Intergenic
1104248813 12:127069741-127069763 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1105027800 12:132861128-132861150 TAACACTGGGAGGCCAAGGCAGG - Intronic
1105202456 13:18191876-18191898 GCACTCTGAGAGGCCAAGACAGG + Intergenic
1106535860 13:30642205-30642227 GCACACTGGGAGGCCAAGGCAGG - Intronic
1107296402 13:38913896-38913918 GCACACTGGGAGGCCAAGGCAGG + Intergenic
1107807573 13:44168852-44168874 GAACTCTTGGAGGCCAAGGCAGG + Intergenic
1107846400 13:44518098-44518120 CAACACTTGGAGGCCAACGCTGG - Intronic
1107898046 13:44985805-44985827 GAACACTTAGAGACCATGATAGG - Intronic
1108257871 13:48628176-48628198 GCACATTGGGAGGCCAAGACAGG - Intergenic
1109099543 13:58163361-58163383 GCACATTTGGAGGCCAAGATGGG + Intergenic
1110305353 13:73980911-73980933 GCACTCTGAGAGGCCAAGACAGG + Intronic
1111881195 13:93959407-93959429 GCACACTGGGAGGCCAAGACAGG - Intronic
1112322267 13:98418519-98418541 CAACACTGGGAGGCCAAGGCGGG - Intronic
1112488039 13:99837199-99837221 GCACTCTGGGAGGCCAAGACAGG + Intronic
1112540024 13:100299958-100299980 GCACTCTGGGAGGCCAAGACGGG - Intronic
1112728820 13:102336060-102336082 GAACACTTAGAGGCCATGTAGGG - Intronic
1113478451 13:110602458-110602480 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1114001619 14:18257186-18257208 GAACACTTTGAGGCCTATAGTGG - Intergenic
1114194897 14:20468889-20468911 GAGCACATCCAGGCCCAGACCGG - Intergenic
1114276679 14:21152839-21152861 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1115991658 14:39156236-39156258 GAACTCTGGGAGGCCAAGGCGGG + Intronic
1116562155 14:46394060-46394082 GAACACTTAGAGGCCAATGTAGG - Intergenic
1117464656 14:55980474-55980496 GAACACTTAGAGGCCATTGCAGG - Intergenic
1118222341 14:63866723-63866745 CAGCACTTGGAGGCCAAGGCAGG + Intronic
1118368942 14:65119748-65119770 GAACACTTCCAGGCCAAGTGTGG + Intergenic
1118413001 14:65502155-65502177 GACCACTTGGAGGCCAACATGGG - Intronic
1119209355 14:72818431-72818453 GCACACTGGGAGACCAAGACGGG + Intronic
1119240144 14:73052647-73052669 GTGCATTGCGAGGCCAAGACAGG - Intergenic
1120253385 14:82088380-82088402 GAACTTTGAGAGGCCAAGACAGG - Intergenic
1120974483 14:90236566-90236588 GCACTCTGCGAGGCCAAGACAGG - Intergenic
1121109917 14:91305473-91305495 TAACACTTCAAGGAAAAGACTGG + Intronic
1121821870 14:96976379-96976401 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1122170412 14:99869511-99869533 GAACACTTAGAGGCCATTATAGG - Intronic
1122432551 14:101664492-101664514 GCACCTTGCGAGGCCAAGACAGG - Intergenic
1122507150 14:102238905-102238927 GAACACTCCCAGGGGAAGACTGG + Intronic
1123001198 14:105295357-105295379 GAACTTTGAGAGGCCAAGACGGG + Intronic
1124521932 15:30412163-30412185 GCACATTGGGAGGCCAAGACAGG - Intronic
1124536732 15:30554055-30554077 GCACATTGGGAGGCCAAGACAGG + Intronic
1124761920 15:32453537-32453559 GCACATTGGGAGGCCAAGACAGG - Intronic
1124776709 15:32595531-32595553 GCACATTGGGAGGCCAAGACAGG + Intronic
1125011222 15:34878136-34878158 GAACTCTGGGAGGCCAAGGCAGG + Intronic
1125778513 15:42241739-42241761 GCACATTGCGAGGCCAAGGCGGG + Intronic
1125996874 15:44170274-44170296 CAGCACTGGGAGGCCAAGACAGG + Intronic
1126022873 15:44419430-44419452 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1126107896 15:45158972-45158994 GAAGACTTTGAGGAGAAGACTGG + Intronic
1126576287 15:50200178-50200200 CAACACTTTGGGGCCAAGATGGG + Intronic
1126607103 15:50488961-50488983 GCACTTTGCGAGGCCAAGACAGG - Intronic
1126668339 15:51094426-51094448 GACCCCTTCCAGGCCAAGACTGG - Intronic
1126825592 15:52544727-52544749 GCACATTGGGAGGCCAAGACAGG - Intergenic
1126939368 15:53749541-53749563 GAACACTTAGAGGCCATTATAGG - Intronic
1127011195 15:54631096-54631118 GCACACTGAGAGGCCGAGACAGG + Exonic
1127591793 15:60432644-60432666 GCACTCTGGGAGGCCAAGACGGG + Intronic
1127744520 15:61952968-61952990 GTACTCTGGGAGGCCAAGACTGG - Intronic
1128015159 15:64338451-64338473 GCACATTGGGAGGCCAAGACAGG + Intronic
1128574347 15:68760595-68760617 CAGCACTTTGAGGCCAAGGCAGG + Intergenic
1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG + Intergenic
1129432611 15:75511490-75511512 CAACACTGGGAGGCCAAGGCAGG - Intronic
1129744624 15:78009286-78009308 GCACTCTGGGAGGCCAAGACAGG + Intronic
1129804892 15:78447694-78447716 GCACACTGGGAGGCCAAGGCAGG - Intronic
1129867064 15:78917065-78917087 GCACTTTTGGAGGCCAAGACAGG - Intergenic
1130350994 15:83091677-83091699 GCACTTTTGGAGGCCAAGACGGG + Intergenic
1130527816 15:84722298-84722320 GCACTCTGAGAGGCCAAGACAGG - Intergenic
1131049597 15:89337746-89337768 GAACTCTGGGAGGCCAAGGCGGG - Intergenic
1131498039 15:92932106-92932128 GCACTCTGGGAGGCCAAGACAGG - Intronic
1132063629 15:98712854-98712876 GCACATTGGGAGGCCAAGACCGG - Intronic
1132411487 15:101581465-101581487 GAACACTCCTAGACCATGACAGG - Intergenic
1133262229 16:4558365-4558387 CAACACTGGGAGGCCAAGGCGGG + Intronic
1133328549 16:4957360-4957382 GCACACTGAGAGGCCAAGGCAGG - Intronic
1133378316 16:5307922-5307944 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1133724728 16:8526959-8526981 GCACTTTTGGAGGCCAAGACAGG + Intergenic
1133987113 16:10676935-10676957 GCACACTGGGAGGCCAAGGCAGG + Intronic
1134146129 16:11764164-11764186 GCACTTTGCGAGGCCAAGACGGG + Intronic
1134151482 16:11808741-11808763 TAACACTGGGAGGCCAAGGCGGG + Intergenic
1134170985 16:11969499-11969521 GCACATTGGGAGGCCAAGACAGG - Intronic
1134453126 16:14375604-14375626 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1134643832 16:15850646-15850668 CAACACTGGGAGGCCAAGGCAGG + Intronic
1134970750 16:18528706-18528728 GCACTCTGCGAGGCCAACACAGG + Intronic
1135332170 16:21569692-21569714 GGACTCTTCAAGGCCAACACCGG + Intergenic
1135426401 16:22340489-22340511 CAACACTGCGAGGCCAAGATGGG + Intergenic
1137036396 16:35573456-35573478 GAACGCTGGGAGGCCAAGGCGGG - Intergenic
1137393302 16:48099169-48099191 GCACTCTTGGAGGCCAAGGCAGG + Intronic
1138091977 16:54182250-54182272 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1138122180 16:54409603-54409625 TAACACTGGGAGGCCAAGGCAGG - Intergenic
1138573518 16:57891393-57891415 GAACACTGGGAGGCCAAGGCGGG + Intronic
1138661611 16:58522071-58522093 GCACTCTGGGAGGCCAAGACGGG + Intronic
1139212489 16:65093182-65093204 CAACACTGGGAGGCCAAGGCAGG - Intronic
1139840194 16:69872459-69872481 GAACTTTGGGAGGCCAAGACGGG - Intronic
1139840780 16:69877700-69877722 GAACACTTAGAGGCCAATGTAGG + Intronic
1140167927 16:72573390-72573412 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1140373061 16:74423440-74423462 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1140508804 16:75492600-75492622 GCACTCTGGGAGGCCAAGACAGG + Intronic
1140825483 16:78701936-78701958 GAACACTGGGAGGCCGAGATGGG + Intronic
1142025363 16:87810099-87810121 GCACACTGGGAGGCCAAGGCAGG - Intergenic
1142162245 16:88563905-88563927 GCACACTGGGAGGCCAAGTCAGG + Intergenic
1142570815 17:872865-872887 CAACACTGGGAGGCCAAGGCGGG - Intronic
1142884402 17:2903802-2903824 GAACACTTCCAGGCTAGGCCTGG - Intronic
1142996413 17:3763137-3763159 GCACACTGGGAGGCCAAGGCGGG - Intronic
1143088242 17:4433073-4433095 TAACACTGGGAGGCCAAGACAGG - Intergenic
1143133501 17:4696079-4696101 CAACACTGGGAGGCCAAGGCAGG + Intronic
1143224050 17:5285378-5285400 CAACACTGAGAGGCCAAGATGGG - Intronic
1143319827 17:6061061-6061083 GAACTTTGGGAGGCCAAGACGGG - Intronic
1143497404 17:7320379-7320401 GAACTTTTGGAGGCCAAGGCAGG - Intronic
1144045118 17:11448282-11448304 GAACTTTTCGAGGCCAAGGCAGG + Intronic
1144538066 17:16111353-16111375 GCACACTGGGAGGCCAAGGCGGG + Intronic
1144563348 17:16339930-16339952 GCACTCTGGGAGGCCAAGACCGG - Intronic
1144564067 17:16345320-16345342 CAACACTTTGAGGCCGAGGCAGG + Intronic
1144822661 17:18086407-18086429 GAACTCTGGGAGGCCAAGGCTGG + Intergenic
1145034361 17:19530377-19530399 GCACTCTTGGAGGCCAAGGCAGG + Intronic
1146075533 17:29725099-29725121 GCACTCTGGGAGGCCAAGACGGG + Intronic
1146093815 17:29908516-29908538 GAACACTGGGAGGCCAAGGTGGG + Intronic
1146437266 17:32861767-32861789 CAACACTGGGAGGCCAAGGCAGG + Intronic
1147049392 17:37780129-37780151 GAACACTTTGAGGCCACTGCAGG - Intergenic
1147203104 17:38817092-38817114 GAACTTTGGGAGGCCAAGACAGG + Intronic
1147289963 17:39433803-39433825 GTACATTGGGAGGCCAAGACAGG - Intronic
1147639435 17:41986117-41986139 GAACTTTGGGAGGCCAAGACAGG + Intronic
1148040268 17:44701191-44701213 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1148117195 17:45183111-45183133 GGCCACTTGGAGGCCAGGACAGG + Intergenic
1148447620 17:47747675-47747697 GAACACTCTCAGGCTAAGACAGG + Intergenic
1148596389 17:48859350-48859372 CAACACTGGGAGGCCAAGGCAGG + Intronic
1148918968 17:51012323-51012345 GCACTCTGGGAGGCCAAGACAGG + Intronic
1149719492 17:58828708-58828730 GAACTTTGGGAGGCCAAGACAGG - Intronic
1149875462 17:60228260-60228282 GCACACTGGGAGGCCAAGGCAGG - Intronic
1149924217 17:60686770-60686792 GAACTTTGCGAGGCCAAGGCAGG - Intronic
1150061456 17:62072211-62072233 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1150155415 17:62849116-62849138 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1150834116 17:68549246-68549268 GCACATTGGGAGGCCAAGACAGG + Intronic
1150912067 17:69398857-69398879 GAACACTTAGAGGCTATGATAGG - Intergenic
1151082021 17:71340372-71340394 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1151238213 17:72737027-72737049 GCACTCTGGGAGGCCAAGACAGG + Intronic
1151776380 17:76205981-76206003 GCACTCTCAGAGGCCAAGACAGG + Intronic
1152179768 17:78811940-78811962 GCACTCTGAGAGGCCAAGACAGG + Intronic
1152183909 17:78842040-78842062 CAACACTTGGAGGCCAAGGTGGG + Intergenic
1152695032 17:81739897-81739919 GCACATTGGGAGGCCAAGACGGG + Intergenic
1152893203 17:82894737-82894759 GCACTCTGGGAGGCCAAGACGGG + Intronic
1153274581 18:3355356-3355378 CAGCACTTTGAGGCCAAGGCAGG + Intergenic
1154984808 18:21539603-21539625 GCACTCTGGGAGGCCAAGACAGG + Intronic
1155972611 18:32095416-32095438 GCACTTTTGGAGGCCAAGACAGG - Intronic
1156101193 18:33597059-33597081 GCACACTGGGAGGCCAAGGCGGG - Intronic
1156903094 18:42324110-42324132 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1157930425 18:51815653-51815675 GCACTTTTGGAGGCCAAGACGGG - Intergenic
1158477738 18:57795148-57795170 CAACACTAGGAGGCCAAGGCAGG + Intronic
1159005772 18:63009118-63009140 GAACAGTTGGAGCCCAGGACGGG - Intergenic
1159238838 18:65713792-65713814 GCACACTCGGAGGCCAAGGCAGG + Intergenic
1159281992 18:66297445-66297467 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1159538372 18:69744062-69744084 GAACATTGGGAGGCCAAGGCAGG + Intronic
1160152581 18:76406317-76406339 GAACTCTGGGAGGCCGAGACAGG + Intronic
1160408223 18:78657481-78657503 GAACTCTGAGAGGCCAAGACGGG - Intergenic
1160558132 18:79739358-79739380 GAAGACTTGGGGGCCAGGACTGG + Intronic
1161761662 19:6177592-6177614 GCACTCTGGGAGGCCAAGACGGG + Intronic
1161873999 19:6893445-6893467 GCACACTGGGAGGCCAAGGCGGG - Intronic
1162522787 19:11191809-11191831 GCACTCTGGGAGGCCAAGACAGG + Intronic
1162553477 19:11371790-11371812 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1163315347 19:16537247-16537269 GAACACATGGAGGCCAAGGGAGG - Intronic
1163467664 19:17477958-17477980 GCACTCTGGGAGGCCAAGACAGG - Intronic
1163549270 19:17956494-17956516 GAACTTTGGGAGGCCAAGACAGG + Intronic
1163566643 19:18055754-18055776 GCACATTGAGAGGCCAAGACAGG + Intergenic
1163598749 19:18235415-18235437 GCACTTTTGGAGGCCAAGACGGG - Intronic
1163877045 19:19880456-19880478 GAACAGTGGGAGGCCAAGGCAGG + Intronic
1163961445 19:20698720-20698742 GAACATTAAGAGGCCAAGACAGG + Intronic
1164124017 19:22293738-22293760 GCACTCTCAGAGGCCAAGACAGG - Intronic
1164270797 19:23670002-23670024 GAAAACTTCTTGGCCCAGACTGG - Intronic
1164702861 19:30298122-30298144 GAACTTTGGGAGGCCAAGACGGG - Intronic
1164972944 19:32547939-32547961 GCACTCTGGGAGGCCAAGACGGG + Intergenic
1165143028 19:33713804-33713826 CAACACTAGGAGGCCAAGGCGGG - Intronic
1165242337 19:34478901-34478923 GAACACTGGGAGGCTGAGACGGG - Intergenic
1165776932 19:38410175-38410197 GAACACTTCCCTGCCCAGACTGG + Intronic
1165899472 19:39162205-39162227 GAACTTTTGGAGGCCAAGGCAGG - Intronic
1166037374 19:40178699-40178721 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1166530248 19:43538337-43538359 GGACATTGGGAGGCCAAGACAGG - Intergenic
1167015304 19:46837420-46837442 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1167137656 19:47626966-47626988 GCACTCTGGGAGGCCAAGACGGG - Intronic
1167188318 19:47964193-47964215 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1167913499 19:52722113-52722135 GTACATTGCAAGGCCAAGACAGG + Intronic
1168077436 19:53989019-53989041 GCACTCTGGGAGGCCAAGACAGG + Exonic
1168111487 19:54193953-54193975 GAACTTTTGGAGGCCAAGGCAGG + Exonic
1168603682 19:57740887-57740909 GCACTTTTGGAGGCCAAGACGGG - Intronic
1202704329 1_KI270713v1_random:11005-11027 GCACATTGGGAGGCCAAGACAGG - Intergenic
925104189 2:1275673-1275695 GAACACTTCAAGGCCATTCCAGG - Intronic
925144123 2:1569573-1569595 GCACACTGGGAGGCCAAGATGGG + Intergenic
925299795 2:2803733-2803755 GAACACCTAGAGGCCATTACAGG + Intergenic
927546745 2:23960879-23960901 GAACTCTGGGAGGCCAAGGCGGG - Intronic
927710343 2:25321652-25321674 GCACTCTGAGAGGCCAAGACAGG + Intronic
927833808 2:26374814-26374836 GCACTCTGGGAGGCCAAGACGGG - Intronic
927834207 2:26379026-26379048 GAACTTTAGGAGGCCAAGACAGG + Intronic
928552863 2:32390560-32390582 GCACTCTAGGAGGCCAAGACGGG - Intronic
929212103 2:39368418-39368440 GAACATTGGGAGGCCAAGGCAGG + Intronic
929228691 2:39537453-39537475 GCACACTGGGAGGCCAAGGCAGG + Intergenic
929515225 2:42600785-42600807 GAACTTTGCGAGGCCAAGGCAGG - Intronic
929698715 2:44142774-44142796 GAACATTGGGAGGCCAAGGCAGG + Intergenic
930315178 2:49788729-49788751 GAACACTTAGAGGCCATTGCAGG + Intergenic
931279596 2:60777706-60777728 GAACACTTAGAGGCCATTAAGGG + Intronic
931326479 2:61230594-61230616 GCACACTGGGAGGCCAAGGCGGG + Intronic
931683885 2:64776396-64776418 GAACACTTTGAGGCCATTGCAGG + Intergenic
933267588 2:80198934-80198956 GCACATTTGGAGGCCAAGGCGGG + Intronic
933906267 2:86896617-86896639 GAAAACTTAGAGGCCATTACAGG - Intergenic
934471686 2:94548644-94548666 GAACACTTTGAGGCCTATAGTGG - Intergenic
935070510 2:99689838-99689860 CAACACTTAGAGGCCAAGGCAGG + Intronic
935345051 2:102100051-102100073 GAATGCCTCGAGGCCAAGCCAGG - Intronic
935465304 2:103389609-103389631 GCACATTGGGAGGCCAAGACAGG - Intergenic
935670349 2:105550778-105550800 GCACTTTGCGAGGCCAAGACAGG - Intergenic
935986679 2:108680122-108680144 GCACTCTGGGAGGCCAAGACGGG + Intronic
936025462 2:109028021-109028043 GCACACTGGGGGGCCAAGACAGG + Intergenic
936102930 2:109599209-109599231 GCACTCTGGGAGGCCAAGACCGG + Intronic
936497785 2:113037401-113037423 GAACTTTGGGAGGCCAAGACAGG + Intronic
937694203 2:124789593-124789615 GAACACTTGGACGCAAAGAGGGG - Intronic
937908056 2:127061967-127061989 GAGCACAGAGAGGCCAAGACAGG + Intronic
938022522 2:127917771-127917793 GAACACTTAGAGGCCATGGTAGG + Intergenic
938042455 2:128086829-128086851 CAACACTGGGAGGCCAAGGCGGG - Intergenic
938534626 2:132227341-132227363 GAACACTTTGAGGCCTATAGTGG + Intronic
938660563 2:133482462-133482484 GGACACTGGGAGGCCAAGGCAGG - Intronic
938820221 2:134950038-134950060 TAACACTTTGAGGCCAAGGTGGG - Intronic
938895781 2:135748781-135748803 GAACTTTGGGAGGCCAAGACAGG + Intronic
939267572 2:139893078-139893100 GCACATTGCGAGGCCAAGGCGGG + Intergenic
939985407 2:148825264-148825286 GAACTTTGGGAGGCCAAGACGGG - Intergenic
940113581 2:150182497-150182519 GCACACTGGGAGGCCCAGACAGG - Intergenic
940184800 2:150972126-150972148 GAACACTTCGAGGCCATTATAGG + Intergenic
940991967 2:160106483-160106505 GAACTTTGGGAGGCCAAGACAGG - Intronic
941016409 2:160362424-160362446 GAACACTTGGAGGCCACTGCAGG + Intronic
941988726 2:171533950-171533972 GAACTTTGGGAGGCCAAGACAGG - Intronic
942110300 2:172675230-172675252 GAACACTTAGAGGCCACTATAGG - Intergenic
942627720 2:177920814-177920836 GAACTTTGGGAGGCCAAGACAGG + Intronic
943045777 2:182860618-182860640 CAGCACTGCGAGGCCAAGGCAGG + Intronic
944055442 2:195517742-195517764 CAACACTGGGAGGCCAAGACAGG + Intergenic
944059049 2:195552941-195552963 GAACACTTAGAGGCCATCATAGG + Intergenic
944247281 2:197544316-197544338 GCACACTGGGAGGCCAAGGCAGG - Intronic
944529586 2:200654074-200654096 GAACACTTAGAGGCCACTGCAGG - Intronic
944642797 2:201745292-201745314 GAACTTTGGGAGGCCAAGACTGG - Intronic
944697828 2:202218700-202218722 GAACTCTGGGAGGCCGAGACGGG + Intronic
944718612 2:202400395-202400417 GAACTTTTGGAGGCCAAGGCAGG - Intronic
944740035 2:202603043-202603065 GCACTTTTCGAGGCCAAGGCGGG + Intergenic
945077299 2:206052561-206052583 GAACTTTGGGAGGCCAAGACAGG + Intronic
945493564 2:210483252-210483274 GAACACATAAAGGCCAAGAAGGG + Intronic
945739001 2:213638001-213638023 GCACTCTGGGAGGCCAAGACGGG - Intronic
945964596 2:216172713-216172735 CAAAACTTGGAGGCCAAGGCAGG - Intronic
946731894 2:222717803-222717825 CAACACTGAGAGGCCAAGGCGGG + Intergenic
946976340 2:225156460-225156482 CAACACTGGGAGGCCAAGGCAGG - Intergenic
947437035 2:230081735-230081757 CAACACTGGGAGGACAAGACAGG - Intergenic
948475114 2:238212738-238212760 GAACATTGGGAGGCCAAGGCGGG - Intergenic
1168847520 20:955503-955525 GAACGCTTGGAGGACAAGGCAGG + Intergenic
1169164834 20:3414166-3414188 TAGCACTTTGAGGCCAAGGCAGG - Intergenic
1169346474 20:4832498-4832520 GAACTCTGGGAGGCCAAGACTGG + Intergenic
1169357526 20:4920012-4920034 GCACTCTGGGAGGCCAAGACGGG + Intronic
1169518458 20:6344624-6344646 GAACACTTCGAGGTCATTATGGG + Intergenic
1170061455 20:12263873-12263895 GCACACTGGGAGGCCAAGACAGG - Intergenic
1170225853 20:13991501-13991523 GAAAAATTCCAGGCCAAGAATGG - Intronic
1170237791 20:14126946-14126968 GAACACTTAGAGGCCACTGCAGG - Intronic
1170852343 20:20016891-20016913 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1171860884 20:30401911-30401933 GAACTTTTAGAGGCCAAGGCAGG + Intergenic
1172370978 20:34390997-34391019 GCACTCTGGGAGGCCAAGACGGG - Intronic
1172756051 20:37285245-37285267 GAACTTTGCGAGGCCAAGGCAGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173162342 20:40662346-40662368 GAACTCTGGGAGGCCAAGGCGGG - Intergenic
1173374512 20:42471458-42471480 GAACACTACGTGGCCAAAGCAGG - Intronic
1174047604 20:47744648-47744670 CAACACTGGGAGGCCAAGGCAGG - Intronic
1174232420 20:49057077-49057099 GCACACTGGGAGGCCAAGGCAGG + Intronic
1174369932 20:50079736-50079758 TAACACTGGGAGGCCAAGGCAGG - Intergenic
1174468945 20:50741205-50741227 GAACACTTCGAGGCCAAGACGGG - Intronic
1174589128 20:51631256-51631278 GAGCACCCCCAGGCCAAGACAGG + Intronic
1174611951 20:51805001-51805023 GCACTCTGGGAGGCCAAGACTGG + Intergenic
1174620157 20:51867969-51867991 GAACTTTTGGAGGCCAAGGCAGG + Intergenic
1174646589 20:52091249-52091271 GCACACTGGGAGGCCAAGGCAGG + Intronic
1174834425 20:53842828-53842850 CAACACTTAGAGGCCATCACAGG - Intergenic
1175067265 20:56300035-56300057 CAACACTTTGAAGCCAAGGCGGG + Intergenic
1175168005 20:57059795-57059817 GAACACTTGGAGGCCAATGTAGG + Intergenic
1176324294 21:5373731-5373753 GAACACTTTGAGGCCTATAGTGG + Intergenic
1176482026 21:7307389-7307411 GAACACTTTGAGGCCTATAGTGG + Intergenic
1176703688 21:10092464-10092486 GAACACTGGGAGGCCAAGGTGGG - Intergenic
1176715495 21:10346132-10346154 GCACTCTGAGAGGCCAAGACAGG - Intergenic
1176763500 21:12987715-12987737 GAACACTTTGAGGCCCATGCTGG - Intergenic
1176763784 21:12993207-12993229 GAACACTTTGAGGCCTATAGTGG - Intergenic
1176881230 21:14196578-14196600 GAACTCTGGGAGGCCAAGGCAGG + Intronic
1177305386 21:19308523-19308545 GCACACTGGGAGGCCAAGGCAGG - Intergenic
1178014945 21:28334444-28334466 GAACTTTGGGAGGCCAAGACTGG + Intergenic
1178064598 21:28890125-28890147 GCACCTTTGGAGGCCAAGACGGG - Intergenic
1178243743 21:30932388-30932410 GAACCCTGGGAGGCCAAGATGGG + Intergenic
1178558471 21:33615398-33615420 GCACTCTGTGAGGCCAAGACAGG - Intronic
1178780366 21:35597766-35597788 CAACACTAGGAGGCCAAGGCAGG + Intronic
1178834029 21:36080886-36080908 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1178990606 21:37352461-37352483 GCACTTTTGGAGGCCAAGACGGG + Intergenic
1179112349 21:38458177-38458199 GCACTTTTGGAGGCCAAGACGGG + Intronic
1179148709 21:38792427-38792449 GAACACTTGGAGGCCACTGCAGG + Intergenic
1180296035 22:10936724-10936746 GAACTTTTAGAGGCCAAGGCAGG - Intergenic
1180412640 22:12629285-12629307 GAACTTTTAGAGGCCAAGGCAGG + Intergenic
1180426129 22:15187982-15188004 GAACACTTTGAGGCCTATAGTGG - Intergenic
1180503262 22:15959631-15959653 GAACACTTTGAGGCCAATGGTGG - Intergenic
1180602854 22:17033821-17033843 GCACTCTGAGAGGCCAAGACAGG + Intergenic
1180611426 22:17100610-17100632 GAACAAACAGAGGCCAAGACTGG + Intronic
1180676825 22:17592238-17592260 GAAAACTTCTAGGCCTAAACAGG + Exonic
1180846598 22:18986184-18986206 GAACTTTTGGAGGCCGAGACAGG + Intergenic
1180870711 22:19145415-19145437 GAACTTTGAGAGGCCAAGACAGG + Intergenic
1181302119 22:21888083-21888105 GAACTCTGGGAGGCCAAGATTGG - Intergenic
1181479171 22:23186980-23187002 GCACTCTGGGAGGCCAAGACGGG - Intronic
1181584153 22:23843877-23843899 GAACCCTGGGAGGCCAAGGCCGG + Intergenic
1181930622 22:26398241-26398263 GAACACTTAGAGGCCATTGCAGG + Intergenic
1182182132 22:28361109-28361131 GAACACTTAGAGGCCATTATAGG - Intronic
1182237915 22:28891001-28891023 GAGCACTGGGAGGCCAAGGCAGG - Intronic
1182406235 22:30134150-30134172 GCACTCTGCGAGGCCAAGGCGGG + Intronic
1182645241 22:31803456-31803478 GAACTTTGGGAGGCCAAGACGGG - Intronic
1182670933 22:31995368-31995390 GTACTCTGGGAGGCCAAGACAGG - Intergenic
1182713543 22:32337284-32337306 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1182806832 22:33079471-33079493 GAACTTTGGGAGGCCAAGACGGG - Intergenic
1183243013 22:36672402-36672424 CAACACTGGGAGGCCAAGGCAGG - Intronic
1183882509 22:40846744-40846766 GAACTCTGGGAGGCCAAGACGGG + Intronic
1183998248 22:41652610-41652632 GCACTCTGGGAGGCCAAGACAGG - Intronic
1184185268 22:42860599-42860621 GCACACTGGGAGGCCAAGGCGGG - Intronic
1184673814 22:46029382-46029404 GAACTTTGGGAGGCCAAGACGGG + Intergenic
1185178015 22:49341334-49341356 GAACACTTAGAGGCCATGGTGGG - Intergenic
1185248952 22:49789585-49789607 GCACCCATAGAGGCCAAGACTGG - Intronic
1185271783 22:49933149-49933171 GCACTCTGCGAGGCCAAGGCAGG - Intergenic
1185415707 22:50708875-50708897 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1203330833 22_KI270738v1_random:85762-85784 GAACACTTTGAGGCCTATAGTGG - Intergenic
1203335313 22_KI270739v1_random:62881-62903 GAACACTTTGAGGCCAATGGTGG + Intergenic
949393914 3:3594819-3594841 GAACTTTGGGAGGCCAAGACAGG - Intergenic
949531674 3:4961953-4961975 CAGCACTTTGAGGCCAAGGCAGG + Intergenic
949984644 3:9530953-9530975 GAACACTTAGAGGCCATAACAGG + Intronic
950068576 3:10133993-10134015 GCACATTGGGAGGCCAAGACGGG + Intergenic
950632429 3:14291656-14291678 GAACACTTAGAGGCCATCATTGG - Intergenic
951119418 3:18907547-18907569 GCACATTGGGAGGCCAAGACAGG + Intergenic
951885341 3:27518838-27518860 TAGCACTTGGAGGCCAAGGCTGG + Intergenic
952397873 3:32937200-32937222 GAACTTTGGGAGGCCAAGACAGG + Intergenic
953040040 3:39248340-39248362 GCACTTTTGGAGGCCAAGACGGG + Intergenic
953121678 3:40049610-40049632 GAACACTTAGAGGCCATTATAGG - Intronic
953561095 3:43994742-43994764 GAACACCGAGAGGCCAGGACCGG - Intergenic
953940390 3:47089999-47090021 GAACTCTGAAAGGCCAAGACAGG + Intronic
953991223 3:47484967-47484989 CAACACTGGGAGGCCAAGGCGGG - Intergenic
954061465 3:48071293-48071315 GAACTCTGGGAGGCCAAGATGGG + Intronic
954557274 3:51527915-51527937 GCACACTGGGAGGCCAAGGCAGG - Intergenic
954603701 3:51892574-51892596 CAACACTTGGAGGCCGAGATGGG + Intergenic
954891722 3:53936824-53936846 GCACTTTGCGAGGCCAAGACAGG - Intergenic
955062325 3:55504023-55504045 GAACTTTGGGAGGCCAAGACAGG + Intergenic
955679309 3:61483803-61483825 CAACACTGGGAGGCCAAGGCAGG + Intergenic
955832888 3:63023604-63023626 GCACTTTTGGAGGCCAAGACAGG + Intergenic
956135273 3:66092266-66092288 GCACTTTTGGAGGCCAAGACAGG - Intergenic
956174278 3:66458454-66458476 GCACACTGGGAGGCCAAGGCAGG + Intronic
956413195 3:68999973-68999995 GAACTTTTGGAGGCCAAGGCAGG + Intronic
956441698 3:69287047-69287069 GCACTTTTGGAGGCCAAGACAGG - Intronic
956627870 3:71284316-71284338 GCACTTTGCGAGGCCAAGACGGG + Intronic
957062878 3:75496361-75496383 CAACACTAGGAGGCCAAGGCAGG - Intergenic
957661501 3:83161003-83161025 GCACATTGGGAGGCCAAGACAGG - Intergenic
957788874 3:84915296-84915318 GCACATTTGGAGGCCAAGGCAGG + Intergenic
958139748 3:89546983-89547005 GAACAATTCGAAGATAAGACAGG + Intergenic
958820988 3:98973505-98973527 GAACTTTGGGAGGCCAAGACAGG - Intergenic
960601652 3:119464658-119464680 CAACACTGGGAGGCCAAGGCAGG + Intronic
961252865 3:125521407-125521429 CAACACTGGGAGGCCAAGGCCGG + Intergenic
961290513 3:125843069-125843091 CAACACTGGGAGGCCAAGGCGGG + Intergenic
961411601 3:126726179-126726201 GAACACTTAGAGGCCATTGCAGG + Intronic
962543722 3:136410151-136410173 GAACTCTGGGAGGCCAAGGCAGG + Intronic
962794821 3:138840995-138841017 GAACTTTGCGAGGCCAAGGCAGG + Intergenic
962917206 3:139915221-139915243 GTACTCTTCCAGGCCAGGACAGG + Intergenic
963507383 3:146204041-146204063 GAACACTCAGAGGCCATCACAGG + Intronic
964217682 3:154305521-154305543 CAACACTTTGAGGCCAAGATGGG + Intronic
965079740 3:164021010-164021032 GAACACTTCCAGGGGAGGACTGG - Intergenic
965452195 3:168851858-168851880 AAACACTTTGAGGAAAAGACAGG - Intergenic
965750651 3:171971598-171971620 GCACACTGGGAGGCCAAGACAGG + Intergenic
966437749 3:179907558-179907580 GCACAATGAGAGGCCAAGACAGG - Intronic
967174393 3:186849970-186849992 TAACACTTAGAGGCAAGGACTGG + Intronic
967205274 3:187113916-187113938 GCACTCTGGGAGGCCAAGACAGG - Intergenic
967485978 3:190031389-190031411 GCACTTTTGGAGGCCAAGACAGG + Intronic
968127739 3:196172276-196172298 CAACACTGGGAGGCCAAGGCAGG + Intergenic
968155380 3:196376797-196376819 GAACTCTGGGAGGCCAAGGCTGG + Intronic
968165819 3:196464440-196464462 GAACACTGGGAGGCCGAGGCGGG - Intergenic
968169630 3:196499574-196499596 GCACTTTTGGAGGCCAAGACAGG + Intronic
968539714 4:1159323-1159345 GAACACTTAGAGGCCACTGCAGG + Intergenic
968815977 4:2822109-2822131 GAACTTTAGGAGGCCAAGACAGG - Intronic
969006771 4:4026480-4026502 CAACACTGGGAGGCCAAGGCAGG - Intergenic
970123521 4:12783988-12784010 GCACTCTGGGAGGCCAAGACGGG - Intergenic
971423058 4:26491430-26491452 CAACACTGGGAGGCCAAGGCAGG - Intergenic
971458554 4:26869046-26869068 GCACTTTTCGAGGCCAAGATGGG + Intronic
971938584 4:33186577-33186599 GAACTTTGGGAGGCCAAGACAGG + Intergenic
972451057 4:39198617-39198639 GCACTCTGGGAGGCCAAGACAGG + Intronic
972747607 4:41953621-41953643 GAGCACTTAGAGGCCATTACAGG + Intronic
973676627 4:53269776-53269798 CAACACTGGGAGGCCAAGGCGGG + Intronic
973682639 4:53336759-53336781 GAACTTTGGGAGGCCAAGACAGG - Intronic
973763731 4:54144693-54144715 GAACCTTGGGAGGCCAAGACAGG - Intronic
974743776 4:66042695-66042717 GAACATTAGGAGGCCAAGGCGGG + Intergenic
975141553 4:70923701-70923723 GCACTCTTGGAGGCCAAGGCGGG + Intronic
976204272 4:82609602-82609624 GCACTCTGGGAGGCCAAGACAGG + Intergenic
977483808 4:97615788-97615810 CAACACTGGGAGGCCGAGACAGG + Intronic
978210587 4:106131364-106131386 GAACTCTGGGAGGCCAAGGCGGG + Intronic
978467823 4:109028353-109028375 GCACACTGGGAGGCCAAGACAGG - Intronic
979532928 4:121788207-121788229 GAACTGTTCGAGGGCAACACTGG + Intergenic
980009547 4:127580161-127580183 CAACACTTCGAGGCTAAGGCGGG + Intergenic
980375902 4:131948816-131948838 GAACACTGGGAGGCCAAGGTGGG - Intergenic
981119603 4:141034640-141034662 GAACACTTAGAGGCCACGGTAGG + Intronic
981170622 4:141618942-141618964 GAACTTTGGGAGGCCAAGACAGG + Intergenic
981302920 4:143210338-143210360 TAACACTTGGAGGCCAAGGCAGG + Intronic
982699891 4:158648864-158648886 GCACTCTGGGAGGCCAAGACGGG + Intronic
982755094 4:159208584-159208606 GAACACTGGAAGTCCAAGACTGG - Intronic
984109774 4:175597679-175597701 GAACTCTGAGAGGCCAAGGCAGG - Intergenic
984174492 4:176399394-176399416 GAACACTTAGAGGCCAATGTAGG - Intergenic
984244045 4:177253292-177253314 GAACTTTGGGAGGCCAAGACAGG - Intergenic
984258594 4:177416941-177416963 GAACACTTAGAGGCCATTATAGG + Intergenic
984531780 4:180924653-180924675 GCACATTGGGAGGCCAAGACAGG - Intergenic
984548555 4:181134215-181134237 TAATTCTTCAAGGCCAAGACAGG + Intergenic
984643799 4:182199215-182199237 GAACTTTGGGAGGCCAAGACAGG + Intronic
984651463 4:182275069-182275091 GCACGCTGGGAGGCCAAGACAGG - Intronic
984825429 4:183919848-183919870 GCACACTGGGAGGCCAAGGCAGG - Intronic
985254837 4:188059398-188059420 GAACTTTGGGAGGCCAAGACAGG - Intergenic
985286952 4:188345389-188345411 GCACTCTGGGAGGCCAAGACGGG + Intergenic
986836479 5:11644426-11644448 GCACCCTGGGAGGCCAAGACGGG + Intronic
986981759 5:13456192-13456214 GAACATTGGGAGGCCAAGGCGGG - Intergenic
987130715 5:14857406-14857428 GCACTCTGGGAGGCCAAGACAGG + Intronic
987139003 5:14926651-14926673 GAACTTTGGGAGGCCAAGACAGG - Intergenic
987283622 5:16435849-16435871 GCACTCTGGGAGGCCAAGACTGG - Intergenic
987627681 5:20423697-20423719 GCACTTTTGGAGGCCAAGACGGG + Intronic
987665335 5:20931234-20931256 GAACACTTAGAGGCCATCGCAGG + Intergenic
987828198 5:23061031-23061053 GAACTTTGGGAGGCCAAGACAGG - Intergenic
988018913 5:25597970-25597992 CAACACTGAGAGGCCAAGGCAGG - Intergenic
988407057 5:30837320-30837342 GCACTTTTGGAGGCCAAGACAGG + Intergenic
988563395 5:32300826-32300848 GCACTCTGGGAGGCCAAGACGGG + Intronic
988655535 5:33207381-33207403 GAACACTTAGAGGCCAAAGTAGG - Intergenic
988757361 5:34270949-34270971 GAACACTTAGAGGCCATCGCAGG - Intergenic
989001075 5:36761436-36761458 GAACACTTAGAGGCCATTATAGG + Intergenic
989031679 5:37125989-37126011 GAACTCTGGGAGGCCAAGGCAGG + Intronic
989069967 5:37499797-37499819 GCACTCTGGGAGGCCAAGACAGG - Intronic
989148627 5:38274517-38274539 AAACACTTACAGGCCAAGAGAGG + Intronic
990446954 5:55902375-55902397 CAGCACTTTGAGGCCAAGACGGG + Intronic
991394150 5:66185807-66185829 GAAAACTTAGAGGCCATGATAGG - Intergenic
991522764 5:67518858-67518880 GCACTCTGGGAGGCCAAGACAGG - Intergenic
992435045 5:76748088-76748110 GCACTTTTCGAGGCCAAGGCGGG + Intergenic
992558367 5:77925973-77925995 GCACTCTTGGAGGCCAAGGCAGG + Intergenic
992562596 5:77967219-77967241 GCACTTTTCGAGGCCAAGGCGGG + Intergenic
992835651 5:80638717-80638739 GAACTCTGGGAGGCCAAGGCGGG - Intronic
994415309 5:99462766-99462788 GAAAACTTTGACGCAAAGACAGG + Intergenic
994714645 5:103306924-103306946 GCACTTTTGGAGGCCAAGACAGG - Intergenic
995285465 5:110383714-110383736 GCACTTTTGGAGGCCAAGACAGG + Intronic
996067103 5:119091456-119091478 CAACACTGGGAGGCCAAAACAGG - Intronic
996067464 5:119095099-119095121 GAACCTTGGGAGGCCAAGACAGG - Intronic
996086745 5:119312650-119312672 GCACACTGGGAGGCCAAGGCAGG + Intronic
996390337 5:122953349-122953371 GCACTCTGGGAGGCCAAGACGGG - Intronic
996811724 5:127523056-127523078 GCACTCTGGGAGGCCAAGACGGG - Intronic
997378276 5:133414718-133414740 AAACACTTCGAGGTAAATACCGG + Intronic
997940813 5:138155771-138155793 GCACTTTGCGAGGCCAAGACAGG - Intronic
998420099 5:141977035-141977057 GAACTCTGGGAGGCCAAGGCGGG - Intronic
998455566 5:142269984-142270006 GCACACTGGGAGGCCAAGGCAGG - Intergenic
998839399 5:146237183-146237205 GAACTGTGGGAGGCCAAGACAGG - Intronic
999260269 5:150234057-150234079 CAGCACTTTGAGGCCAAGGCGGG - Intronic
999754117 5:154652004-154652026 GAACTCTCGGAGGCCAAGGCAGG + Intergenic
1000583279 5:163061348-163061370 GAACTCTGGGAGGCCAAGGCGGG + Intergenic
1000662098 5:163949778-163949800 GAACTCTTAAAGGCCAAAACAGG - Intergenic
1000795317 5:165657207-165657229 GAACTCTGGGAGGCCAAGGCGGG - Intergenic
1000863488 5:166484996-166485018 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1001011950 5:168106812-168106834 GCACTCTGGGAGGCCAAGACAGG + Intronic
1001369778 5:171187069-171187091 GAATACTTGGAGGCCATCACAGG + Intronic
1001813316 5:174647222-174647244 GCACACTGGGAGGCCAAGGCAGG - Intergenic
1001916916 5:175569644-175569666 GCACATTGGGAGGCCAAGACAGG - Intergenic
1001968298 5:175931240-175931262 GCACATTGGGAGGCCAAGACAGG + Intronic
1001968442 5:175933099-175933121 GCACACTGGGAGGCCAAGACGGG + Intronic
1001992276 5:176127813-176127835 GAACTTTGGGAGGCCAAGACAGG + Intronic
1002119113 5:176987881-176987903 AAACTCTGAGAGGCCAAGACTGG + Intronic
1002248997 5:177910684-177910706 GCACACTGGGAGGCCAAGACGGG - Intergenic
1002249144 5:177912549-177912571 GCACATTGGGAGGCCAAGACAGG - Intergenic
1002377800 5:178800783-178800805 GAACACTGGGAGGCCGAGGCAGG + Intergenic
1002539601 5:179897569-179897591 GCACTCTGGGAGGCCAAGACGGG - Intronic
1003141639 6:3476550-3476572 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1003602923 6:7534532-7534554 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1003659896 6:8050431-8050453 GAACACTTAGAGGCCATGTGGGG - Intronic
1003749928 6:9043645-9043667 GAACTCTGGGAGGCCAAGGCAGG - Intergenic
1003888179 6:10539835-10539857 CAACACTGGGAGGCCAAGGCAGG + Intronic
1004244180 6:13956569-13956591 GCACTCTGGGAGGCCAAGACGGG - Intronic
1004359702 6:14960232-14960254 GCACATTGGGAGGCCAAGACAGG + Intergenic
1005024449 6:21449183-21449205 GCACTCTGGGAGGCCAAGACGGG + Intergenic
1005362793 6:25047484-25047506 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1005402230 6:25446808-25446830 GAACACTTAGAGGCCATTGCAGG + Intronic
1005828003 6:29647201-29647223 GCACTCTTGGAGGCCAAGGCAGG - Intergenic
1005914206 6:30338366-30338388 GAACACTTAGAGGCCATTGCAGG + Intronic
1005937819 6:30537293-30537315 CAGCACTTTGAGGCCAAGGCAGG + Intergenic
1006268653 6:32947039-32947061 GAAGACTTTGAGGCCCAGAGAGG + Intronic
1006658782 6:35621374-35621396 GAACTTTGGGAGGCCAAGACAGG + Intronic
1007223684 6:40298083-40298105 GAACACTTCATGGCCAAGGATGG - Intergenic
1007311894 6:40953365-40953387 GAAACCTGCGAGGTCAAGACTGG + Intergenic
1008293318 6:49746025-49746047 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1008941490 6:57050560-57050582 GCACACTGGGAGGCCAAGACAGG - Intronic
1009028411 6:58027443-58027465 GAACTCTGGGAGGCCAAGGCAGG - Intergenic
1009203941 6:60778826-60778848 GAACTCTGGGAGGCCAAGGCAGG - Intergenic
1009485495 6:64217280-64217302 GAACTTTGGGAGGCCAAGACAGG + Intronic
1009525221 6:64735327-64735349 GCACTCTTGGAGGCCAAGGCAGG - Intronic
1011342108 6:86327573-86327595 CAACACTGGGAGGCCAAGATAGG - Intergenic
1011585105 6:88916224-88916246 CAGCACTTGGAGGCCAAGGCGGG + Intronic
1013030876 6:106331436-106331458 GAACACTTAGAGGCCATTATAGG - Intergenic
1013491790 6:110654692-110654714 GAACATTGGGAGGCCAAGGCGGG + Intronic
1013595659 6:111658331-111658353 CAACACTGAGAGGCCAAGGCAGG + Intergenic
1014264875 6:119265343-119265365 GAACTTTTGGAGGCCAAGGCAGG - Intronic
1014528282 6:122527462-122527484 GAACACTTAGATGCCATGGCAGG + Intronic
1015015042 6:128402496-128402518 GCACACTGGGAGGCCAAGACGGG - Intronic
1015520405 6:134124874-134124896 GAACTTTAGGAGGCCAAGACAGG - Intergenic
1015558472 6:134487694-134487716 GCACACTGGGAGGCCAAGGCAGG - Intergenic
1016703437 6:147079407-147079429 GCACACTGGGAGGCCAAGGCGGG - Intergenic
1016834453 6:148463389-148463411 CAGCACTTTGAGGCCGAGACGGG - Intronic
1017134302 6:151134691-151134713 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1017460795 6:154647748-154647770 GAACTTTGCGAGGCCAAGGCAGG + Intergenic
1017490083 6:154937353-154937375 CAGCACTTTGAGGCCAAGGCAGG - Intronic
1017734688 6:157350558-157350580 GAACACTTAGAGGCCATTATAGG - Intergenic
1017949366 6:159123053-159123075 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1018023698 6:159788339-159788361 CAACACTGCGAGGCCGAGGCAGG + Intronic
1018456918 6:163961473-163961495 GCACTCTGGGAGGCCAAGACGGG - Intergenic
1018751679 6:166812106-166812128 GAACTTTGGGAGGCCAAGACGGG + Intronic
1019192537 6:170261485-170261507 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1019663593 7:2239964-2239986 GCACTTTTGGAGGCCAAGACAGG + Intronic
1020032977 7:4945819-4945841 GCACTCTTTGAGGCCAAGGCGGG - Intronic
1020063635 7:5170877-5170899 CAACACTGGGAGGCCAAGGCGGG - Intergenic
1020259852 7:6525056-6525078 GAACTTTAGGAGGCCAAGACGGG + Intronic
1020460997 7:8429940-8429962 GCACACTGGGAGGCCAAGAGGGG + Intergenic
1021089637 7:16468030-16468052 GCACTCTAAGAGGCCAAGACAGG + Intronic
1021241458 7:18207183-18207205 GCACACTGGGAGGCCAAGGCAGG - Intronic
1023210820 7:37803101-37803123 GCACTTTTGGAGGCCAAGACAGG - Intronic
1023433585 7:40119306-40119328 GCACACTGGGAGGCCAAGGCAGG + Intergenic
1023476904 7:40590289-40590311 GAACACTTCAAGGCCAATATAGG - Intronic
1023802935 7:43850654-43850676 AAACAGTTCCAGGCCATGACAGG - Intergenic
1024126435 7:46302274-46302296 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1024302837 7:47901091-47901113 GAACTCTGGGAGGCCAAGGCAGG + Intronic
1024511867 7:50211008-50211030 GAAGACAGCGTGGCCAAGACGGG + Intergenic
1024788331 7:52933933-52933955 GATCACTTGGAGTTCAAGACTGG + Intergenic
1025312135 7:57961446-57961468 GAGCACTTTGAGGCCAACAGTGG - Intergenic
1026322337 7:69278574-69278596 CAACACTGGGAGGCCGAGACAGG + Intergenic
1026772595 7:73211848-73211870 GAACTCTGGGAGGCCAAGGCAGG - Intergenic
1026928911 7:74212189-74212211 CAACACTGGGAGGCCGAGACAGG - Intronic
1027013459 7:74765248-74765270 GAACTCTGGGAGGCCAAGGCAGG - Intergenic
1027074579 7:75180785-75180807 GAACTCTGGGAGGCCAAGGCAGG + Intergenic
1027122983 7:75535604-75535626 GAACTTTGGGAGGCCAAGACGGG - Exonic
1027133176 7:75605780-75605802 CAACACTGGGAGGCCAAGGCAGG - Intronic
1027237840 7:76308552-76308574 GCACACTGGGAGGCCAAGGCAGG + Intergenic
1027327503 7:77059894-77059916 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1027381195 7:77611689-77611711 GCACACTGGGAGGCCAAGGCGGG - Intronic
1027788681 7:82612572-82612594 TAACACTTAGAGGCCGAGGCGGG + Intergenic
1028558749 7:92150215-92150237 CAACACTGAGAGACCAAGACAGG + Intronic
1028587121 7:92463403-92463425 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1029501204 7:100931339-100931361 GCACTTTTGGAGGCCAAGACGGG + Intergenic
1029778678 7:102707911-102707933 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1029984692 7:104912273-104912295 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1030038778 7:105431454-105431476 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1030291092 7:107873102-107873124 GCACTCTTGGAGGCCAAGGCAGG - Intergenic
1030827007 7:114170379-114170401 GAACACTTAGAGGCCATTGCAGG - Intronic
1030996027 7:116359291-116359313 GCACTTTTGGAGGCCAAGACGGG + Intronic
1031117891 7:117687954-117687976 GCACTTTTCGAGGCCAAGGCAGG - Intronic
1031518817 7:122737455-122737477 GCACACTGGGAGGCCAAGGCAGG - Intronic
1031843980 7:126781960-126781982 CAACACTGAGAGGCCAAGATGGG - Intronic
1031858110 7:126946253-126946275 GAACATTGGGAGGCCAAGGCAGG + Intronic
1032226727 7:130038040-130038062 TAACACTGGGAGGCCAAGACAGG - Intronic
1033261147 7:139845059-139845081 GAACACTTGGGAGTCAAGACTGG - Intronic
1033354443 7:140588155-140588177 GCACTTTTGGAGGCCAAGACAGG - Intronic
1033439074 7:141362357-141362379 GTACACTTCAAAGCCAAAACAGG - Intronic
1033467199 7:141604826-141604848 GAACAATTGGAGGCCGAGGCAGG - Intronic
1033468648 7:141622700-141622722 GAACACTTAGAGGCCAAGTAGGG - Intronic
1033520049 7:142151254-142151276 GATGACTTCGAGGCAGAGACTGG + Intronic
1034185178 7:149170487-149170509 CAGCACTTTGAGGCCAAGGCGGG + Intronic
1034568799 7:151937965-151937987 GAACACTTAGAGGCCATTGCAGG - Intergenic
1035157217 7:156924017-156924039 GAAGACTTGGACGCCATGACGGG + Intergenic
1035987151 8:4446865-4446887 GAACATTGGGAGGCCAAGGCGGG - Intronic
1037254856 8:16941991-16942013 GAACACGTCCTGGCCCAGACGGG + Intergenic
1037956265 8:23062462-23062484 GCACTTTGCGAGGCCAAGACAGG - Intronic
1038939378 8:32286748-32286770 TAACACTTAGAGGCCGAGGCAGG + Intronic
1039505074 8:38046147-38046169 GCACACTGGGAGGCCAAGGCAGG - Intronic
1039522817 8:38185807-38185829 GAACTCTGGGAGGCCAAGGCAGG - Intronic
1040368804 8:46747623-46747645 GGACATTGGGAGGCCAAGACAGG - Intergenic
1040459800 8:47636388-47636410 GAACACTTCGAGGCCACTGGAGG - Intronic
1040685808 8:49871566-49871588 GAACACTTGGAGGCCACGGGCGG + Intergenic
1040930090 8:52725085-52725107 GTACTCTGGGAGGCCAAGACGGG + Intronic
1041042394 8:53860717-53860739 GCACTCTGGGAGGCCAAGACAGG + Intronic
1041131285 8:54704258-54704280 GAACACTTAGAGGCCATTATAGG + Intergenic
1041283389 8:56234392-56234414 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1041926245 8:63240027-63240049 GAACACTTAGAGGCCATTGCAGG + Intergenic
1041964726 8:63662777-63662799 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1042215409 8:66426087-66426109 GAACACTGGGAGGCCAAGGCGGG - Intergenic
1042249814 8:66744750-66744772 GCACACTGCGAGGCCAAGGCGGG - Intronic
1042521554 8:69717024-69717046 CAACATTGGGAGGCCAAGACAGG - Intronic
1042910947 8:73825555-73825577 GAACTTTGGGAGGCCAAGACAGG + Intronic
1043432159 8:80205631-80205653 GCACTTTTGGAGGCCAAGACAGG + Intronic
1043955304 8:86352469-86352491 GAACTTTGGGAGGCCAAGACGGG - Intronic
1043990870 8:86752515-86752537 GAATACTTAGAGGCCATCACAGG + Intergenic
1044259606 8:90102244-90102266 GAACACTTAGAGGCCATTATAGG + Intergenic
1044625220 8:94230113-94230135 GCACACTGGGAGGCCAAGTCAGG + Intergenic
1045193455 8:99906182-99906204 GAACTCTGGGAGGCCAAGACAGG - Intergenic
1046327517 8:112669275-112669297 GCACTCTGGGAGGCCAAGACAGG - Intronic
1047225631 8:122953485-122953507 GACCAGTTAGCGGCCAAGACTGG + Exonic
1047410743 8:124622546-124622568 GCACTCTTGGAGGCCAAGGCAGG + Intronic
1047494621 8:125400710-125400732 GCACTTTTCGAGGCCAAGGCGGG + Intergenic
1047902789 8:129442249-129442271 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1048588124 8:135794668-135794690 GAACTTTTGGAGGCCAAGGCAGG - Intergenic
1049085083 8:140472214-140472236 GCACTCTGGGAGGCCAAGACAGG + Intergenic
1049505630 8:142995131-142995153 GCACACTGGGAGGCCAAGGCAGG - Intergenic
1049557174 8:143288913-143288935 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1050006006 9:1131147-1131169 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1050755481 9:8997635-8997657 GAACACTTTGAGGCCATTATAGG - Intronic
1051249945 9:15149373-15149395 GCACACTGGGAGGCCAAGGCAGG - Intergenic
1051995692 9:23214565-23214587 GAACTTTTGGAGGCCAAGGCAGG + Intergenic
1052898296 9:33768608-33768630 GCACTCTGGGAGGCCAAGACAGG + Intronic
1052947697 9:34181360-34181382 GCACTCTGGGAGGCCAAGACGGG - Intronic
1052993253 9:34534903-34534925 GCACTTTTGGAGGCCAAGACAGG - Intergenic
1053061855 9:35038017-35038039 CAACACTGGGAGGCCAAGGCAGG + Intergenic
1053142794 9:35691367-35691389 GAACACTGCGAGGTCAGGCCAGG - Intergenic
1053481284 9:38418298-38418320 GAAGACACTGAGGCCAAGACTGG - Intronic
1053640953 9:40079484-40079506 GAACACTGGGAGGCCAAGGTGGG - Intergenic
1053687402 9:40549149-40549171 GAACTCTTTGAGGCCAACAGTGG + Intergenic
1053765185 9:41385984-41386006 GAACACTGGGAGGCCAAGGTGGG + Intergenic
1053938654 9:43201330-43201352 GAACACTTTGAGGCCAATAGTGG + Intergenic
1053939216 9:43212657-43212679 GAACTCTTTGAGGCCAACAGTGG + Intergenic
1054077242 9:60547992-60548014 GAACACTTTGAGGCCAATAGTGG - Intergenic
1054151154 9:61606132-61606154 GCACACTGGGAGGCCAAGGCGGG + Intergenic
1054276347 9:63077355-63077377 GAACTCTTTGAGGCCAACAGTGG - Intergenic
1054321641 9:63675465-63675487 GAACACTGGGAGGCCAAGGTGGG - Intergenic
1054398485 9:64687576-64687598 GAACTCTTTGAGGCCAACAGTGG + Intergenic
1054422264 9:64951669-64951691 GAACACTTTGAGGCCTATAGTGG + Intergenic
1054543799 9:66297146-66297168 GAACACTGGGAGGCCAAGGTGGG + Intergenic
1055087206 9:72326411-72326433 GAACTTTGCGAGGCCAAGGCAGG - Intergenic
1055296816 9:74841749-74841771 GAACTCTGGGAGGCCAAGGCAGG - Intronic
1055426338 9:76200744-76200766 GATCACTTGGAGGCCCAGGCAGG + Intronic
1056201318 9:84279699-84279721 GCACACTGGGAGGCCAAGGCGGG - Intronic
1056242180 9:84658789-84658811 GCACTTTTGGAGGCCAAGACAGG - Intergenic
1056651080 9:88463277-88463299 GAACACTTGCAGGGCAAAACTGG - Intronic
1056730972 9:89166505-89166527 AAACGCTTCAAGGCCGAGACTGG + Intronic
1057580814 9:96286440-96286462 GCACATTGGGAGGCCAAGACAGG + Intronic
1057597833 9:96431486-96431508 GCACTTTTGGAGGCCAAGACAGG - Intergenic
1058427911 9:104891717-104891739 GAACTTTGCGAGGCCAAGGCAGG + Intronic
1058447756 9:105068833-105068855 CAACACTTTGAGGCCAAGGCGGG - Intergenic
1058849407 9:108996208-108996230 CAACACTTGGAGGCCAAGGCGGG - Intronic
1059226349 9:112676416-112676438 GCACTTTTGGAGGCCAAGACAGG + Intergenic
1059247165 9:112858266-112858288 GCACTCTGGGAGGCCAAGACAGG + Intronic
1060580731 9:124743978-124744000 GAACTCTGGGAGGCCAAGGCAGG + Intronic
1060616674 9:125022706-125022728 AGACTCTTCGAGGCCAAGAGCGG - Intronic
1060800235 9:126539832-126539854 GCACATTGGGAGGCCAAGACGGG + Intergenic
1061105485 9:128526901-128526923 GTACTCTAGGAGGCCAAGACAGG - Intronic
1061118969 9:128631577-128631599 GAACTTTGGGAGGCCAAGACAGG + Intronic
1061148090 9:128812084-128812106 CAACACTGGGAGGCCAAGGCAGG - Intergenic
1061171562 9:128959784-128959806 CAACACTTGGAGGCCAAAGCAGG - Intronic
1061174125 9:128982182-128982204 GAACTTTGGGAGGCCAAGACAGG + Intronic
1061210422 9:129189105-129189127 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1061249621 9:129418914-129418936 GCACTTTTGGAGGCCAAGACGGG + Intergenic
1061358870 9:130127947-130127969 GAACACTGGGAGGCCAAGGTGGG - Intronic
1061557702 9:131381984-131382006 AAACTCTGGGAGGCCAAGACAGG - Intergenic
1061639978 9:131945711-131945733 CAACACTGGGAGGCCAAGGCAGG + Intronic
1061697380 9:132387195-132387217 CAACACTGGGAGGCCAAGGCAGG - Intronic
1202788725 9_KI270719v1_random:62559-62581 GAACACTGGGAGGCCAAGGTGGG - Intergenic
1202802890 9_KI270720v1_random:17744-17766 GAACTTTTAGAGGCCAAGGCAGG - Intergenic
1203356937 Un_KI270442v1:161149-161171 GAACACTTTGAGGCCTACAGTGG - Intergenic
1185566076 X:1096437-1096459 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1185588484 X:1258084-1258106 GCACTTTGCGAGGCCAAGACAGG + Intergenic
1186304077 X:8235272-8235294 GAACACTCAGAGGCCATTACAGG + Intergenic
1186707855 X:12161403-12161425 GCACATTTGGAGGCCAAGGCAGG - Intronic
1187395492 X:18915622-18915644 GCACATTGGGAGGCCAAGACAGG - Intronic
1188138981 X:26525352-26525374 GAACACTTAGAGGCCATTGCAGG - Intergenic
1188826183 X:34838114-34838136 GAACTCTGGGAGGCCAAGGCGGG - Intergenic
1188997910 X:36908248-36908270 GCACTTTTGGAGGCCAAGACAGG - Intergenic
1189080787 X:37969878-37969900 GCACACTGGGAGGCCAAGGCTGG - Intronic
1189174573 X:38942736-38942758 GAACACTTAGAGGCCATTGCGGG - Intergenic
1189347903 X:40256203-40256225 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1189369659 X:40417571-40417593 GAACTCTGGGAGGCCGAGACGGG - Intergenic
1189380447 X:40499041-40499063 GAACTCTGGGAGGCCAAGACAGG + Intergenic
1189447343 X:41093111-41093133 CAACACTGGGAGGCCAAAACAGG - Intronic
1189508150 X:41634006-41634028 GTACATTTGGAGGCCAAGGCGGG - Intronic
1189643517 X:43100507-43100529 GAACTTTGGGAGGCCAAGACGGG - Intergenic
1190082722 X:47369420-47369442 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1190168647 X:48093986-48094008 GAACTTTGGGAGGCCAAGACGGG + Intergenic
1190302420 X:49064551-49064573 GAGCACTGGGAGGCCAAGGCGGG - Exonic
1190705518 X:53023763-53023785 GAACATTGGGAGGCCAAGACGGG - Intergenic
1191262668 X:58343662-58343684 AAACACTTTGAGGCCAATTCTGG + Intergenic
1191779106 X:64847604-64847626 GAACACTTCCAGGGGAAGATTGG + Intergenic
1191891733 X:65950388-65950410 GCACTCTGGGAGGCCAAGACAGG - Intergenic
1192701082 X:73474107-73474129 GAACACTTAGAGGCCATTACAGG + Intergenic
1193433552 X:81442421-81442443 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1193863383 X:86698780-86698802 GCACTCTGGGAGGCCAAGACAGG - Intronic
1194364724 X:93000771-93000793 GAACACTTAGAGGCCATTATAGG - Intergenic
1194481455 X:94430936-94430958 GCACTTTTGGAGGCCAAGACGGG - Intergenic
1194563810 X:95456320-95456342 GCACATTTGGAGGCCAAGGCAGG + Intergenic
1194724753 X:97382342-97382364 GCACACTGGGAGGCCAAGCCGGG + Intronic
1195028263 X:100900305-100900327 GAACTTTGGGAGGCCAAGACAGG - Intergenic
1195201397 X:102553617-102553639 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1195637419 X:107133581-107133603 GCACATTGAGAGGCCAAGACAGG - Intronic
1196811698 X:119634118-119634140 GCACTCTGGGAGGCCAAGACGGG + Intronic
1196981203 X:121215252-121215274 GCACTCTGGGAGGCCAAGACCGG + Intergenic
1197053804 X:122093511-122093533 GAACACTGTGATGCCAACACTGG + Intergenic
1198090426 X:133323230-133323252 GCACTCTGAGAGGCCAAGACAGG + Intronic
1198461807 X:136870582-136870604 CAACACTGGGAGGCCGAGACAGG + Intronic
1198821080 X:140649473-140649495 GAACACTGGGAGGCCAAGGTGGG - Intergenic
1199995571 X:153023347-153023369 GAACTTTGGGAGGCCAAGACAGG + Intergenic
1200241931 X:154500972-154500994 GCACTTTTGGAGGCCAAGACAGG - Intergenic
1200672952 Y:6117032-6117054 GAACACTTAGAGGCCATTATAGG - Intergenic
1201665353 Y:16447208-16447230 GAACTCTGGGAGGCCAAGGCAGG - Intergenic