ID: 1174472245

View in Genome Browser
Species Human (GRCh38)
Location 20:50769652-50769674
Sequence AAGACACTATGGTATTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174472245_1174472248 1 Left 1174472245 20:50769652-50769674 CCAACCAAATACCATAGTGTCTT 0: 2
1: 0
2: 0
3: 12
4: 174
Right 1174472248 20:50769676-50769698 AATACTACTCATTTCGCCCATGG 0: 2
1: 0
2: 1
3: 6
4: 46
1174472245_1174472251 27 Left 1174472245 20:50769652-50769674 CCAACCAAATACCATAGTGTCTT 0: 2
1: 0
2: 0
3: 12
4: 174
Right 1174472251 20:50769702-50769724 ATTATGCCTAAGCCACCATACGG 0: 2
1: 0
2: 0
3: 4
4: 77
1174472245_1174472252 28 Left 1174472245 20:50769652-50769674 CCAACCAAATACCATAGTGTCTT 0: 2
1: 0
2: 0
3: 12
4: 174
Right 1174472252 20:50769703-50769725 TTATGCCTAAGCCACCATACGGG 0: 2
1: 0
2: 1
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174472245 Original CRISPR AAGACACTATGGTATTTGGT TGG (reversed) Intergenic
906643460 1:47456098-47456120 AAGAAAATATGGTATTGGCTGGG + Intergenic
908132279 1:61084681-61084703 AAGACACTAATGTATCTGTTAGG - Intronic
908173617 1:61532088-61532110 AAGACACAATTGTATATTGTTGG - Intergenic
908510262 1:64845462-64845484 AGGACACTCTGGTTTCTGGTGGG + Intronic
909033028 1:70564214-70564236 AAGAGACTATGGTGTTTTCTAGG + Intergenic
909462073 1:75928300-75928322 CAGACACTATGTTATTTATTGGG - Intronic
909763913 1:79330707-79330729 ATGACACTGTGGTATTTTTTTGG + Intergenic
910243845 1:85118173-85118195 AAGAAACTATAGTGTTTTGTTGG + Intronic
910854741 1:91684246-91684268 AAGACACTGTAGGATTTGGAGGG + Intronic
910910328 1:92227244-92227266 AAGAACTTATGGTATTTGGCCGG + Intronic
912219074 1:107651225-107651247 CAGAGTCTATGGTATTTTGTTGG + Intronic
912930716 1:113957760-113957782 AAGAGCCTATGAGATTTGGTGGG + Intronic
916631722 1:166621952-166621974 AAGAGACTTTGGTCTTTGATGGG + Intergenic
916642834 1:166749680-166749702 CAGACACTATGGTAACTGCTAGG - Intergenic
917833742 1:178922567-178922589 AAGACAATATGGTATTGGTTGGG - Intergenic
918131427 1:181632922-181632944 AAAAGACTATGGTATTTTTTAGG - Intronic
919266424 1:195272955-195272977 AAGAGCTTATGGTATATGGTAGG - Intergenic
920551625 1:206866354-206866376 AAGACACAAAGGTATGTGCTTGG + Exonic
920909829 1:210206035-210206057 AAGACAGTGTGGTATTGGCTGGG - Intergenic
920955879 1:210619668-210619690 AAGGCAATGTGGCATTTGGTGGG - Intronic
921438134 1:215151418-215151440 AAGACAATATGGTATTGGACAGG - Intronic
1070569820 10:77632425-77632447 GAAACACTGTGGCATTTGGTGGG - Intronic
1071133103 10:82418553-82418575 ATGACATTATGTTATTTGTTGGG + Intronic
1075076126 10:119351643-119351665 AAGACACTATTATAGGTGGTAGG + Intronic
1075893119 10:125971262-125971284 CAGACACTATGGGAATGGGTAGG - Intronic
1078983874 11:16570066-16570088 AAGGCACTATGGGATTTAGATGG - Intronic
1083701615 11:64482937-64482959 AAGAAACTTTGGTTTTGGGTGGG + Intergenic
1084651757 11:70493691-70493713 AAGCCAGTGTGGTATCTGGTGGG + Intronic
1086323933 11:85679376-85679398 AAGACACTATGCTAAGTGGTAGG - Intronic
1086742419 11:90384054-90384076 AAGACATTTTGGTATTAGGTGGG + Intergenic
1089847549 11:121470386-121470408 AAGGCACTCTGGTATTTTCTTGG - Intronic
1093655725 12:21692242-21692264 AAGAGACTATGGGATTTTCTAGG - Intronic
1098510857 12:71312517-71312539 TAGACACCATGGAATTTTGTAGG - Intronic
1100159040 12:91836112-91836134 AAGACAATATTTTATTTGGATGG + Intergenic
1100729960 12:97454043-97454065 CAGACACTTTGGTATATGTTGGG - Intergenic
1100910635 12:99357663-99357685 AAGACACTGTGTTATGTGTTAGG - Intronic
1102775708 12:115516885-115516907 CAGACACTCTGGAATTGGGTAGG - Intergenic
1110197653 13:72808917-72808939 GAGAAACTAAGGTATTTGTTAGG + Intronic
1111727233 13:92027874-92027896 AAGACATATTGGTATTTGGTGGG - Intronic
1112741820 13:102483420-102483442 TAGGCCCTGTGGTATTTGGTTGG - Intergenic
1112975899 13:105316674-105316696 AAGACACTAAGATATTTGTGTGG - Intergenic
1115035506 14:28851970-28851992 ATGACACTACCGTATTTAGTTGG - Intergenic
1116010407 14:39344897-39344919 ATGACAATATGGTATTAGGTTGG - Intronic
1116077913 14:40135456-40135478 AAGAGACTATGGGATTTTTTAGG + Intergenic
1116832908 14:49740130-49740152 ATGAAATAATGGTATTTGGTGGG + Exonic
1118834390 14:69466168-69466190 AAAACACAATGGTAATTGTTGGG + Intergenic
1118881861 14:69835296-69835318 AAGAAACTATAGTATTTGCAAGG - Intergenic
1118965328 14:70577708-70577730 GAGACTCTATGGTATTCCGTTGG - Intergenic
1119575878 14:75721436-75721458 AATACACTAGGGTCTTTGATGGG + Intronic
1125028715 15:35055414-35055436 AATTGACTAAGGTATTTGGTGGG + Intergenic
1125042035 15:35199743-35199765 AAGACAAAATGGCTTTTGGTGGG + Intergenic
1125268274 15:37909290-37909312 AATATACTTTGATATTTGGTAGG - Intergenic
1130935070 15:88463145-88463167 AAGACAGAATGGAATATGGTAGG - Intronic
1131866241 15:96713748-96713770 CAGGCACTATGGTAAGTGGTTGG + Intergenic
1135246147 16:20858744-20858766 AATACACTTTGATATTTGTTTGG + Exonic
1136844983 16:33569118-33569140 AAGACACCATGGTTTCAGGTGGG - Intergenic
1137834848 16:51582360-51582382 AATACATTTTGATATTTGGTAGG + Intergenic
1137870664 16:51947146-51947168 AAGACACTTTTCTATGTGGTGGG - Intergenic
1138319901 16:56102870-56102892 AAGAAAATATGATATTAGGTTGG + Intergenic
1138807289 16:60105839-60105861 AAGACACTAAAGCATTTGGTGGG - Intergenic
1140826065 16:78707902-78707924 AAGTCACAATGCTATTCGGTTGG + Intronic
1140847219 16:78902256-78902278 AAGATACAAAGGCATTTGGTGGG - Intronic
1203106691 16_KI270728v1_random:1417771-1417793 AAGACACCATGGTTTCAGGTGGG - Intergenic
1203155151 16_KI270728v1_random:1869416-1869438 AAGACACCATGGTTTCAGGTGGG - Intergenic
1146362625 17:32190001-32190023 AAAAAATTATGGTATTTGGCTGG - Intronic
1147837624 17:43346136-43346158 AATACACTTTGATATTTGTTTGG - Intergenic
1155659789 18:28234753-28234775 AAGACAATATTATATTAGGTTGG - Intergenic
1155779714 18:29815657-29815679 CAGACACTATGATATTTTCTAGG - Intergenic
1158334991 18:56406499-56406521 AAGACACTGTGGTAGATGTTTGG + Intergenic
1158385298 18:56982681-56982703 TAGAGGCTTTGGTATTTGGTGGG - Intronic
1158415502 18:57246709-57246731 GAGACAGGATGGAATTTGGTGGG - Intergenic
1161928584 19:7320392-7320414 AAGAAAATATGGTATATGGCCGG + Intergenic
1162239017 19:9333364-9333386 AAAACACTAGGGAATTTGGCAGG - Intronic
1163269350 19:16241553-16241575 AGGTCACTATGCTATTTGGGAGG + Intronic
1163919685 19:20276870-20276892 AATACACTATGGAAGTTGGCAGG + Intergenic
1165298306 19:34946881-34946903 AAGACACTGTGGTACTGGGGAGG + Intergenic
925494421 2:4430636-4430658 AAAAAAATATGGTATTAGGTTGG + Intergenic
926209433 2:10858524-10858546 AAGATACTTTGGTATTGGGAAGG - Intergenic
929287040 2:40147033-40147055 AAGCCATTATGGTCTTTGTTGGG + Intronic
930341634 2:50123393-50123415 AAGCAAACATGGTATTTGGTTGG + Intronic
931539722 2:63316788-63316810 CAGAGACTATGGGATTTTGTAGG - Intronic
932540938 2:72651571-72651593 AAGAAACTATTGTATTAGGATGG - Intronic
936799166 2:116245319-116245341 AAGACCCCATGGTATTTACTTGG + Intergenic
936892752 2:117391710-117391732 AAGACACTGTTGTAAGTGGTGGG - Intergenic
937283036 2:120733485-120733507 AAGACAGAATGTTTTTTGGTTGG - Intergenic
937645564 2:124262596-124262618 AAGACACTAGAGTTTTTGGGTGG + Intronic
937759704 2:125586321-125586343 GCCAAACTATGGTATTTGGTAGG - Intergenic
938436482 2:131286300-131286322 GAGACACCATGGGCTTTGGTCGG - Intronic
938712107 2:133983836-133983858 CAGACATTTTGGTATTTGGCAGG - Intergenic
939901385 2:147854674-147854696 TAGACACTATGGTAAGTGCTTGG + Intronic
944281016 2:197897451-197897473 AAGACACTATGGCTATTAGTTGG - Intronic
944302077 2:198135001-198135023 AATACATTCTGGTATTTGGTTGG - Intronic
945807381 2:214506477-214506499 AAGATACTATGGTTTCTGTTGGG + Intronic
946770320 2:223082510-223082532 AAGCCACTATGTTATTAGGAGGG + Intronic
1169994566 20:11541985-11542007 GAGACACTGTGGTATCTTGTAGG + Intergenic
1170718615 20:18854892-18854914 AAGATACTATGCTAGTGGGTAGG + Intergenic
1170760563 20:19245644-19245666 AAGACACCATTGGATTAGGTTGG + Intronic
1172002812 20:31793539-31793561 AAGAGACTAAGGTATATGCTTGG + Intronic
1174454552 20:50640069-50640091 AAGACACTATGGTATTTGGTTGG + Intronic
1174472245 20:50769652-50769674 AAGACACTATGGTATTTGGTTGG - Intergenic
1178056468 21:28804669-28804691 AAGAGACAATGGCACTTGGTAGG + Intergenic
1178113205 21:29390829-29390851 AAGACACTAAATTATTTAGTTGG + Intronic
1178806818 21:35846246-35846268 CAGACACTATGCTATCTGGAGGG + Intronic
1180511858 22:16099358-16099380 AAGATAGGATGGTATTTGCTGGG + Intergenic
1181098616 22:20523581-20523603 ATGGCTCTGTGGTATTTGGTGGG - Intronic
950274396 3:11646187-11646209 AATACTTAATGGTATTTGGTGGG + Intronic
951815866 3:26753964-26753986 AAGAAAATATGGTATTAGGTTGG + Intergenic
952581112 3:34834857-34834879 AAAAAAGTATGGTATTGGGTTGG - Intergenic
954164386 3:48744579-48744601 AAGACACTTTGGTTTTTAGAGGG + Intronic
955258920 3:57364468-57364490 AAAACACTATGGTACCTGGGAGG - Intronic
957371685 3:79301973-79301995 AAGACAATATTGTAGCTGGTGGG - Intronic
958634749 3:96729412-96729434 AAAAAAATATGGTATTTTGTTGG + Intergenic
959145085 3:102534749-102534771 AAGAGACTATGAAATTTGGGAGG - Intergenic
960103298 3:113767438-113767460 AAGACACTATGCCATATGGAAGG + Intronic
961054291 3:123774839-123774861 AAGACCCTATGCTCTATGGTCGG - Intronic
962857352 3:139359753-139359775 AAGACACCATGGTATTCTGCTGG - Intronic
963095333 3:141532648-141532670 AATACACTAAGGTATTTGGGTGG + Intronic
963541355 3:146593716-146593738 AAGCCACCATAGTTTTTGGTTGG + Intronic
967705697 3:192647919-192647941 AAAACACTTTAGTATTTGATAGG + Intronic
967817455 3:193811494-193811516 AAGACCCCATGGTTTCTGGTTGG + Intergenic
968898433 4:3418764-3418786 TGGACACTATGTTATTAGGTGGG + Intronic
970351737 4:15208307-15208329 AAGACACTATGGCAGGTGCTGGG - Intergenic
972676097 4:41260780-41260802 AAGACAAACTGGGATTTGGTAGG + Exonic
973642376 4:52916199-52916221 CAGACACTGTGGCATTTAGTGGG + Intronic
973752670 4:54038578-54038600 AAGAAACACTGGTATTTGATTGG - Intronic
977092127 4:92690827-92690849 AACAAACTAAGGTTTTTGGTTGG - Intronic
977945436 4:102908004-102908026 ATGTCACTATGATTTTTGGTTGG + Intronic
978130229 4:105186927-105186949 AAGAGACTATTCTATTTGTTGGG + Intronic
978826442 4:113029607-113029629 AAGAAACTATAGTAATTAGTGGG + Intronic
980177911 4:129369033-129369055 AAGACACTATGTTAGGTGCTAGG + Intergenic
990403682 5:55466342-55466364 TATATACTATGGTATTTGCTTGG - Intronic
990555131 5:56925865-56925887 AAGACAGTATGGTATTGGGGGGG + Intronic
991328266 5:65462701-65462723 CAGATACTATGCTATGTGGTAGG + Intronic
993408341 5:87541369-87541391 AAGGCAATATAGTATTTGGAAGG - Intergenic
995334458 5:110983557-110983579 AACACACTGTGGTGGTTGGTCGG + Intergenic
997380870 5:133436804-133436826 AAATCACTCTGGTATTTGGGTGG + Intronic
1000336525 5:160245553-160245575 AAGACACCAAAGCATTTGGTAGG - Intergenic
1001186372 5:169577536-169577558 CAGGCACTATGGTACTTGCTGGG + Intergenic
1001918662 5:175583173-175583195 AAGAGAATATGATATTTGGTTGG - Intergenic
1002936837 6:1681264-1681286 AAGACACGCTGGTACTTGTTGGG + Intronic
1003389490 6:5701089-5701111 AAGGATCTATGGGATTTGGTGGG + Intronic
1004766255 6:18730794-18730816 CAGACACTATGGTGTTTTCTAGG - Intergenic
1005108736 6:22253921-22253943 AAAACACTATGGTAATTATTTGG - Intergenic
1006223993 6:32520965-32520987 AATTCCCTATTGTATTTGGTAGG - Intronic
1006227998 6:32557013-32557035 AATTCCCTATTGTATTTGGTAGG - Intronic
1006230584 6:32583160-32583182 AATTCCCTATTGTATTTGGTAGG - Intronic
1008625731 6:53314567-53314589 AAGGCACTATGGCAAGTGGTAGG + Intronic
1008685717 6:53924353-53924375 AAAAAAGTATTGTATTTGGTTGG - Intergenic
1009997441 6:70912047-70912069 CAGACACTATGGAATTTTCTAGG + Intronic
1011542913 6:88451945-88451967 AAGACATTTTGGTACTTGGTAGG - Intergenic
1011795748 6:90949296-90949318 AAGCAACGATGGTATTAGGTTGG + Intergenic
1013306896 6:108856473-108856495 AAGAAACTAGGGTAATGGGTAGG - Intronic
1014988001 6:128035795-128035817 AAGACTCTATAATATTTAGTGGG + Intronic
1017344496 6:153364614-153364636 TACTCACTATGGTATTTTGTTGG + Intergenic
1018530331 6:164756272-164756294 AAAATACTATGCTATCTGGTGGG + Intergenic
1018598601 6:165513128-165513150 AAAAAAGTATGGTCTTTGGTGGG - Intronic
1020520595 7:9181083-9181105 AAGACATAAAGGTATTGGGTAGG + Intergenic
1021333265 7:19365858-19365880 AAGACAGGATGCTATTTGGAGGG - Intergenic
1022376566 7:29817915-29817937 AACACACTATAGTCTTGGGTAGG - Intronic
1023332732 7:39136315-39136337 AATACATTTTGGTATCTGGTAGG - Intronic
1032378343 7:131447781-131447803 AAGATATTCTGGTATATGGTAGG - Intronic
1036113671 8:5934185-5934207 TAGGCTCTATGGTATTTGGATGG - Intergenic
1038602077 8:28954782-28954804 AAGAAACTATGGTGTGTGGGTGG + Intronic
1040949879 8:52926759-52926781 AAGCCACTATGCTATTTTTTGGG - Intergenic
1042308920 8:67360311-67360333 AAGACACTAGAGTATTGGCTGGG + Intergenic
1046111747 8:109733957-109733979 AAGAAACTAGGGTGTTGGGTGGG + Intergenic
1050276279 9:4004278-4004300 AAGACTCCTTGATATTTGGTAGG + Intronic
1051770296 9:20570807-20570829 AAGAAAATATGGAATTTGTTGGG - Intronic
1052402429 9:28017429-28017451 CAGACACTATGGGATTTTCTAGG - Intronic
1052520073 9:29535425-29535447 CAGAGACTATGGTATTTTCTAGG - Intergenic
1053528919 9:38858648-38858670 AATTCACTGTGGTATTTAGTTGG + Intergenic
1054201147 9:62083083-62083105 AATTCACTGTGGTATTTAGTTGG + Intergenic
1054637212 9:67505281-67505303 AATTCACTGTGGTATTTAGTTGG - Intergenic
1058052212 9:100418302-100418324 AATAAACTATGGTATTTCATAGG - Intergenic
1059583759 9:115582724-115582746 AAGTCACTATGGTATGTGTGTGG + Intergenic
1060108167 9:120887757-120887779 ATCATACTATGATATTTGGTAGG + Intronic
1060464509 9:123891010-123891032 CAGACACTATGGTTTTTGAAGGG - Intronic
1186868758 X:13748354-13748376 AAGACACTATGGTTTTTATCAGG - Intronic
1187439578 X:19306084-19306106 TAGACACCAGGCTATTTGGTCGG - Intergenic
1189920488 X:45898565-45898587 TATACACTATAGGATTTGGTGGG - Intergenic
1193090347 X:77487272-77487294 AAGAGACTGTGGTGTTTTGTAGG - Intergenic
1193598339 X:83476492-83476514 CAGAGACTATGGTATTTTCTAGG - Intergenic
1194085437 X:89521427-89521449 AAGAGACTATGGAATTTTCTAGG + Intergenic
1194314059 X:92352202-92352224 AAAACACTATGTTTTTTTGTAGG - Intronic
1200438080 Y:3177305-3177327 AAGAGACTATGGAATTTTCTAGG + Intergenic
1201513443 Y:14790733-14790755 AAGACACTATTGGATATGGATGG - Intronic
1201777919 Y:17686632-17686654 AAGACAGTCTGTTATTTGCTTGG + Intergenic
1201823639 Y:18219360-18219382 AAGACAGTCTGTTATTTGCTTGG - Intergenic