ID: 1174473177

View in Genome Browser
Species Human (GRCh38)
Location 20:50776541-50776563
Sequence GCAGGCAGCCGGGTGTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174473172_1174473177 -9 Left 1174473172 20:50776527-50776549 CCTTTCCAGCCTCTGCAGGCAGC No data
Right 1174473177 20:50776541-50776563 GCAGGCAGCCGGGTGTTCCCTGG No data
1174473171_1174473177 -8 Left 1174473171 20:50776526-50776548 CCCTTTCCAGCCTCTGCAGGCAG No data
Right 1174473177 20:50776541-50776563 GCAGGCAGCCGGGTGTTCCCTGG No data
1174473168_1174473177 28 Left 1174473168 20:50776490-50776512 CCTCTCTGGAGACTGTCAGGGAG No data
Right 1174473177 20:50776541-50776563 GCAGGCAGCCGGGTGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174473177 Original CRISPR GCAGGCAGCCGGGTGTTCCC TGG Intergenic
No off target data available for this crispr