ID: 1174477339

View in Genome Browser
Species Human (GRCh38)
Location 20:50805333-50805355
Sequence CAGATTGGCCAGAGACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174477337_1174477339 17 Left 1174477337 20:50805293-50805315 CCTGTTCTGGTATTTCATGTGTG 0: 1
1: 0
2: 1
3: 17
4: 311
Right 1174477339 20:50805333-50805355 CAGATTGGCCAGAGACTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174477339 Original CRISPR CAGATTGGCCAGAGACTTGA AGG Intronic
900152154 1:1183372-1183394 CAGCTTGGCCATAGGCCTGAAGG - Intronic
904741199 1:32677376-32677398 TAGCATGCCCAGAGACTTGATGG + Intronic
904826423 1:33276487-33276509 CAGCTTGGGCAGCGACATGACGG - Exonic
905238289 1:36565495-36565517 CAGTTTTGCCAAAGACTTAATGG - Intergenic
907197757 1:52700374-52700396 CAGATTGCACAGGGTCTTGAAGG - Intergenic
908017350 1:59857241-59857263 CAGAATGGGCACAGACTGGATGG - Intronic
909056261 1:70824740-70824762 AACATTGGCCAGAGGCTTCATGG - Intergenic
912101842 1:106217673-106217695 AAGATGAGCCAGAGACTGGAAGG + Intergenic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
912977304 1:114342366-114342388 TTGAATGGCCACAGACTTGAAGG - Intergenic
914321991 1:146573917-146573939 CTGATTGGCCAGAGATATGTAGG - Intergenic
914796142 1:150921977-150921999 CAGTTTGGCCATACACTTGGTGG - Intergenic
917435964 1:175021675-175021697 GAGAGGGGCCAGAGAGTTGATGG - Intronic
919539297 1:198828701-198828723 ATGATTGACCAGAGATTTGATGG - Intergenic
919988186 1:202690242-202690264 CAGCTTGGCCTGTGACTTGCTGG - Intronic
921467449 1:215506250-215506272 CAGACTGTCAAGAGATTTGATGG - Intergenic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
924044389 1:240012337-240012359 CAGATTGGCCAGAAAAGGGAGGG - Intergenic
1063245228 10:4210742-4210764 CACATTGGACAAAGACTTCATGG - Intergenic
1063559945 10:7116457-7116479 CAGATGGGCAAGAGACTGCAGGG + Intergenic
1069964724 10:72105076-72105098 GAGGTTGCCCAGACACTTGAAGG - Intronic
1070728112 10:78806262-78806284 GAGAATGGCTAGAGACTTTATGG - Intergenic
1072204691 10:93192843-93192865 CAGCTTAGCCAGAGACCTCATGG + Intergenic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1076425463 10:130364333-130364355 CAGAAGAGCCATAGACTTGAGGG - Intergenic
1080629794 11:34063613-34063635 CAGATTACCCAGAGTCTTTAAGG - Intronic
1084593576 11:70104467-70104489 CTGGTTGGCCAGACACTGGAGGG - Intronic
1085151082 11:74253376-74253398 CAGATTTGCCAGGGCCTTGGTGG + Intronic
1085331476 11:75655527-75655549 CAGATTGGTCAGATAATGGAAGG + Intronic
1085801838 11:79597285-79597307 CAAATTGGCCTCAGACTTAATGG - Intergenic
1086984986 11:93237903-93237925 AAAATTGGCCAGAGACTGGTGGG - Intergenic
1090415464 11:126537261-126537283 CAGAATGTCCTGAGAGTTGAGGG - Intronic
1096915403 12:55026869-55026891 GAGACTGGCCAGACACCTGAAGG + Exonic
1099269799 12:80493680-80493702 CAGCTTGGCCAGAGACTCTAGGG - Intronic
1100268356 12:93000046-93000068 CTGATGGGCCAGAGACAGGAGGG - Intergenic
1103244408 12:119444024-119444046 CAGAGTGGACAGAGTCCTGATGG - Intronic
1104660905 12:130610947-130610969 CAGAGTGGCCAGGGACTCGCTGG - Intronic
1104723599 12:131060929-131060951 CAGAGTGGACAGAGTCCTGAAGG + Intronic
1107911105 13:45106575-45106597 GAGATAGCCCAGACACTTGAAGG + Intergenic
1115957083 14:38793581-38793603 CAGATTGTGTAGAGGCTTGAAGG + Intergenic
1115964710 14:38874794-38874816 CAAATGGGCAAGAGAGTTGAAGG + Intergenic
1118864782 14:69694440-69694462 CAGCTTGGGCTGAGACTTCACGG - Intronic
1119721592 14:76895134-76895156 GAGTCTGGGCAGAGACTTGATGG - Intergenic
1124475038 15:30025829-30025851 AAGATGGGGCAGACACTTGAGGG + Intergenic
1128333282 15:66770248-66770270 CAGATTAACCAGGGACTTCAGGG + Intronic
1130235368 15:82128316-82128338 CAGATTTTCCACAGACTGGAAGG - Intergenic
1130517676 15:84638726-84638748 CACATTGGGTACAGACTTGATGG - Intergenic
1132880746 16:2160741-2160763 CAGAGAGGCCAGAGAATTGAAGG + Intronic
1135514022 16:23114240-23114262 CAGATAAGCCAGAGACAGGAAGG + Intronic
1135967099 16:27044815-27044837 TAGATTGGCCAGAGCCTTGCTGG - Intergenic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1140011635 16:71137246-71137268 CTGATTGGCCAGAGATATGTAGG + Exonic
1140028144 16:71310778-71310800 CAGAGTGGGCAGAGACTAGAAGG + Intergenic
1144696613 17:17308081-17308103 CAGATTGTCCAAAGAGCTGAAGG + Intronic
1146410429 17:32578923-32578945 CAGATTGTCAAGGAACTTGAAGG - Intronic
1147504129 17:40997835-40997857 TAGATTTGGGAGAGACTTGAGGG + Intergenic
1151030528 17:70732718-70732740 CAAATATGGCAGAGACTTGAAGG + Intergenic
1151875022 17:76863028-76863050 CAGCTTGGCCTGAGGCTTGAGGG + Intergenic
1152100220 17:78297078-78297100 CAGATCGGCCAGTGCTTTGATGG + Intergenic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1154112208 18:11579798-11579820 CAGCTTGGATAGAGACTTGTTGG - Intergenic
1156343143 18:36230463-36230485 CAGATTGGCCAGAGATTCAGGGG + Intronic
1157997854 18:52580952-52580974 CACATTGAACAGATACTTGAAGG - Intronic
1160488557 18:79317356-79317378 AAGATAAGCCAGAGACTTGTAGG + Intronic
1161280905 19:3445341-3445363 CAGCTTGGTCACAGACTTCATGG + Intronic
1162351296 19:10151320-10151342 CAGGTTGGCGAGATACTAGAGGG + Intronic
1163050210 19:14677510-14677532 GAGAATGGCCAGAGAGATGAGGG + Intronic
1166011259 19:39944475-39944497 CACATTAGCAAGAGAATTGAGGG + Intergenic
1166390795 19:42407777-42407799 CATGTTGGCCAGAGACTGGAGGG + Exonic
1167144840 19:47675558-47675580 CAGCTTGGGCAGAGGCGTGAAGG + Intronic
925451115 2:3969781-3969803 CAGCTTGGCCACAGACAGGAAGG - Intergenic
925713160 2:6761207-6761229 CAGATTGGCCATGGCCTTTATGG - Intergenic
926211026 2:10869398-10869420 TAGCTTTGCCAGAGACTTGCTGG + Intergenic
927437951 2:23086587-23086609 CAGATTTGCCCTAGGCTTGAAGG - Intergenic
927842940 2:26456921-26456943 CAGACTGGCCCCAGACCTGAAGG + Intergenic
927972885 2:27316768-27316790 CATAATGGCCAGAGGCCTGATGG + Intronic
928205656 2:29281391-29281413 CAGATTGGTGAGAGAGTGGAAGG - Intronic
928443937 2:31316412-31316434 CAGAGTGTGCAGACACTTGAAGG - Intergenic
928467748 2:31538609-31538631 CAGATTGTCTAGGGTCTTGAAGG - Intronic
929447151 2:42010607-42010629 TAGAATGGCCAGAGACTTCCAGG - Intergenic
930408398 2:50992056-50992078 CAGATTGGACAGAAACTGGGTGG - Intronic
930495730 2:52140083-52140105 TAGTTGGGACAGAGACTTGATGG + Intergenic
932755843 2:74408708-74408730 GAGCTTGCCCAGAGACTTCAAGG - Intergenic
932890889 2:75596752-75596774 CAAATTGGCCACAAACTTGGGGG - Intergenic
933258587 2:80107570-80107592 GAGGTTGCCCAGACACTTGAAGG - Intronic
935193521 2:100796948-100796970 CAGAATTGCCAAAGACTAGAAGG - Intergenic
937292514 2:120790280-120790302 AAGATTATCCAGAAACTTGAAGG - Intronic
937394900 2:121526148-121526170 CAGATTGGCCAGAGCCCTGGGGG - Intronic
937866017 2:126752466-126752488 CAACTTGGCCAGAGGCTGGATGG - Intergenic
937903762 2:127041695-127041717 CAGGCTGGGCAGAGACTTAAAGG - Intergenic
938229579 2:129646970-129646992 CAGAATAAGCAGAGACTTGAAGG + Intergenic
938976498 2:136483266-136483288 GAGATTGACTATAGACTTGAAGG + Intergenic
941413101 2:165185348-165185370 AAGATGGGCAAGGGACTTGAAGG - Intronic
941611819 2:167670369-167670391 CAGCTTGGCTAAAGACTTGGAGG - Intergenic
943298152 2:186163932-186163954 TAGATGGGCCAGGGACTTCAGGG + Intergenic
943527963 2:189041484-189041506 CCGATTGACAAGAGACTTAAGGG - Intronic
944406648 2:199392263-199392285 GAGATTTGCCAGTGAATTGAAGG - Intronic
946267191 2:218556316-218556338 CAGTTTGGCCAGAAAATTCAGGG + Intronic
1168923907 20:1564412-1564434 GACATTGAGCAGAGACTTGAAGG + Exonic
1170079292 20:12453983-12454005 GAGATTTGACAAAGACTTGAAGG - Intergenic
1171499189 20:25579952-25579974 AAGAGTGGTCAGAGACCTGAGGG - Intronic
1172024748 20:31940657-31940679 CAGATTTACTGGAGACTTGATGG + Intronic
1174201341 20:48808690-48808712 CAGATTGCACAGGGCCTTGAGGG - Intronic
1174276751 20:49409621-49409643 CAGATCGGGCAGAGCTTTGAAGG + Intronic
1174477339 20:50805333-50805355 CAGATTGGCCAGAGACTTGAAGG + Intronic
1178105674 21:29316864-29316886 CAGCTTTTCCAGCGACTTGAGGG - Intronic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1178360946 21:31948253-31948275 CAGGTTAGCCAGAGAATGGATGG - Intronic
1179070396 21:38065543-38065565 CAAATTGACCAAACACTTGAAGG + Intronic
1183354810 22:37352471-37352493 CAGAGTGGCCAGTGTCATGAAGG + Intergenic
1184871139 22:47239196-47239218 GAGAGTGGCCAGAGTCTTGCTGG + Intergenic
949571945 3:5301968-5301990 CACATTGCCCAGAGACGTCAGGG - Intergenic
949847191 3:8383748-8383770 CAATTTGGCCTGAGACCTGAAGG + Intergenic
950420703 3:12897385-12897407 CAGACTGTTCAGAGACTTCAAGG - Exonic
951445948 3:22781003-22781025 CAGAGAGGCCAGAAACTGGAAGG + Intergenic
952918402 3:38267050-38267072 CAGATAGTCCAGAAACCTGAGGG + Intronic
952999986 3:38923746-38923768 CAGATGTGCCAGAGATTTGTGGG + Intronic
954988209 3:54814344-54814366 CACACTGGCCAGAGGCTGGAAGG + Intronic
955356146 3:58234771-58234793 CAGATTGGGCAGAGGCCTCAGGG + Intergenic
960548342 3:118944311-118944333 CAGATTAAGCAGAGCCTTGAAGG - Intronic
962265225 3:133939800-133939822 CACATGGGACAGAGACTAGAAGG - Intronic
962410711 3:135139660-135139682 CTGATTGGGAAGTGACTTGATGG + Intronic
965033720 3:163406967-163406989 CTGTTTGTCCAGAGACTAGAGGG + Intergenic
965530258 3:169764477-169764499 CAAATTGGCAGGAGACGTGAAGG - Intergenic
966935295 3:184703934-184703956 CAGATTTGCTAGATACTTTAAGG - Intergenic
967410288 3:189160229-189160251 CAGGTTGACTAGAGATTTGATGG + Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968882969 4:3310558-3310580 AAGAGTGGCCAGGGACTTGGAGG + Intronic
971246616 4:24934898-24934920 CAGATTATCATGAGACTTGAAGG + Intronic
971302959 4:25456892-25456914 CAGATGGGCAAGAGATTTAAGGG - Intergenic
973047171 4:45549174-45549196 CAGAGTGGCCAGAGGCTTTGGGG + Intergenic
976000938 4:80372329-80372351 CAGTTTGGCATGAGACTTGGTGG + Intronic
976762436 4:88564396-88564418 AAGATTAGCCTGACACTTGATGG - Intronic
981245509 4:142532388-142532410 CAGAACGACCAGAGACTTGAAGG - Intronic
982397513 4:154927937-154927959 GAGATGGGGCAGAGACTTTAGGG + Intergenic
983722611 4:170875070-170875092 CCGTTTGGTCAGTGACTTGAGGG - Intergenic
984265982 4:177498390-177498412 CAGATAGGAAAGAGACTTGAAGG + Intergenic
984849781 4:184143644-184143666 CAGATTGCCCAGAGAATTCCGGG - Intronic
985293199 4:188407092-188407114 CAGATTTCACACAGACTTGAAGG - Intergenic
987860428 5:23479721-23479743 TAGTTTGACCGGAGACTTGATGG - Intergenic
991458370 5:66829191-66829213 CAGACTTCCCAGACACTTGACGG - Intronic
991509576 5:67361765-67361787 CAGATTGGAGAGGGACTGGATGG + Intergenic
992120525 5:73587598-73587620 CAGATGGGCCAGAGCCAGGAAGG - Intergenic
1001524247 5:172417311-172417333 CAGATAGCCCAGCGACTTCAGGG - Intronic
1002082546 5:176746072-176746094 CAGATGGGCAAGAGAGTGGAAGG + Intergenic
1002872254 6:1177534-1177556 CACATTAACCAGAGATTTGAGGG + Intergenic
1004456449 6:15796216-15796238 GCAATTGGGCAGAGACTTGAGGG + Intergenic
1007222476 6:40290028-40290050 CAAATTTGCCAGAGACTGGGTGG - Intergenic
1008337230 6:50322186-50322208 CAATTTGGCAAGTGACTTGAGGG - Intergenic
1013612569 6:111808533-111808555 AAGAATGTCCAGAGACTGGAGGG - Intronic
1018351569 6:162965207-162965229 CCTCTTGGCCAGAGTCTTGAAGG + Intronic
1018610328 6:165642135-165642157 CAGCTTGTGCAGAGACCTGAAGG - Intronic
1020227313 7:6290475-6290497 CAGGATGTCCACAGACTTGAAGG + Intergenic
1020446291 7:8272125-8272147 CAGATTGGTGTGAGACTTGGGGG + Intergenic
1021613853 7:22482599-22482621 CAGATTGGCCAGTGACTGAATGG - Intronic
1021880760 7:25093420-25093442 AAGATTGGCCAGAGAAATCACGG - Intergenic
1021948347 7:25750451-25750473 CAGATTACCCAAAGACTTGAGGG - Intergenic
1022254982 7:28647092-28647114 CGAATTAGCCAGAGACTGGAGGG + Intronic
1028692332 7:93667458-93667480 AAGACTGGCCAGAGACTTGCAGG - Intronic
1029908753 7:104121133-104121155 CAGATAGGCAAGATACTTGGGGG + Intergenic
1031024527 7:116665565-116665587 CAGATGGACCAGACACTTCAGGG + Intergenic
1031608644 7:123798932-123798954 CAGATTAGATAGAGCCTTGAAGG + Intergenic
1032691354 7:134290374-134290396 CAGGTTTTCCAGAAACTTGAGGG + Exonic
1040032379 8:42837096-42837118 CACATTTGTCAGAGACTTGAAGG + Exonic
1042659555 8:71139340-71139362 CAGATTGGCCTTTGATTTGAGGG + Intergenic
1043401126 8:79885249-79885271 CAGATTGGGCAGAGCCTTTTCGG + Intergenic
1045712937 8:105006985-105007007 CAGTTAGGCCAGTGACTTGCTGG - Intronic
1046290208 8:112149352-112149374 CAGATTAGGCAGAGTCTTGTAGG - Intergenic
1048731098 8:137441897-137441919 CACATTGCACACAGACTTGAAGG + Intergenic
1049133141 8:140867333-140867355 CAGATTGGCAAGAGAATTTTAGG + Intronic
1050152917 9:2635009-2635031 CAGATTGCCCAGAGACCACAAGG - Intronic
1053333133 9:37235255-37235277 GAGACTGGCCAAAGACTGGATGG - Intronic
1055527682 9:77151764-77151786 CAGTTTGACCAAAGATTTGAAGG + Intergenic
1056280829 9:85039779-85039801 CCATTTGGCCAGAGACTTTAAGG + Intergenic
1058380238 9:104369928-104369950 CATGTTGCCCAGAGACTTGATGG + Intergenic
1059358367 9:113718886-113718908 CAGATTGGCCATAGAGTTGGTGG + Intergenic
1203776090 EBV:73958-73980 CAGCTCGGCCAGGGACGTGACGG + Intergenic
1188252412 X:27913686-27913708 CAGATTAGCCATAGGCTGGAAGG - Intergenic
1188430407 X:30100612-30100634 CATTTTGACCATAGACTTGAAGG + Intergenic
1188821672 X:34783249-34783271 CAGTATGGCAAGATACTTGAGGG - Intergenic
1190099982 X:47515182-47515204 CAGATTTGTCAGAGAATTGAGGG + Intergenic
1197137845 X:123083594-123083616 AAGTTTGGCTAGAGACTTCAAGG + Intergenic
1197988914 X:132296152-132296174 CTGGATGGTCAGAGACTTGAAGG - Intergenic
1198417406 X:136434595-136434617 CAGGTGAGCCAGAGACCTGAAGG - Intergenic
1198849104 X:140946708-140946730 CTTATGGGCCAGAGATTTGAGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic