ID: 1174479152

View in Genome Browser
Species Human (GRCh38)
Location 20:50818756-50818778
Sequence CAGAGAGAACAGAAGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 461}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174479152_1174479154 0 Left 1174479152 20:50818756-50818778 CCTGAATCCTTCTGTTCTCTCTG 0: 1
1: 0
2: 1
3: 38
4: 461
Right 1174479154 20:50818779-50818801 CTTTTACCTCCTACTCTGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 226
1174479152_1174479161 29 Left 1174479152 20:50818756-50818778 CCTGAATCCTTCTGTTCTCTCTG 0: 1
1: 0
2: 1
3: 38
4: 461
Right 1174479161 20:50818808-50818830 CAAATCTACTAGCCTGGCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 114
1174479152_1174479158 23 Left 1174479152 20:50818756-50818778 CCTGAATCCTTCTGTTCTCTCTG 0: 1
1: 0
2: 1
3: 38
4: 461
Right 1174479158 20:50818802-50818824 TTGGCCCAAATCTACTAGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1174479152_1174479155 4 Left 1174479152 20:50818756-50818778 CCTGAATCCTTCTGTTCTCTCTG 0: 1
1: 0
2: 1
3: 38
4: 461
Right 1174479155 20:50818783-50818805 TACCTCCTACTCTGTCTGGTTGG 0: 1
1: 0
2: 0
3: 19
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174479152 Original CRISPR CAGAGAGAACAGAAGGATTC AGG (reversed) Intronic
900471128 1:2855513-2855535 CAGAGAGTTGAGGAGGATTCTGG - Intergenic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
901402805 1:9025956-9025978 CAGACAGAAGGGCAGGATTCGGG + Intronic
902123179 1:14185088-14185110 CTGAGACATCAGAAGGATCCTGG + Intergenic
902463958 1:16603141-16603163 CAGTGAGAACAACAGGGTTCTGG - Intronic
902804998 1:18855486-18855508 CATAGAGAAGAGAAGGAACCAGG - Intronic
903157140 1:21453534-21453556 CAGTGAGAACAACAGGGTTCTGG + Intronic
903265810 1:22157251-22157273 CAGAGAGAACTGAGGCATTGTGG + Intergenic
905015206 1:34773446-34773468 CAGTGAGAACACATGGATACAGG + Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
906100257 1:43255784-43255806 CAGAGAGCAGGGAAGGATCCAGG + Intronic
906159551 1:43637631-43637653 CGGAGGTAAGAGAAGGATTCGGG + Intergenic
906373609 1:45275347-45275369 AAGAGAGAAGAAAAGGATCCTGG - Intronic
906483278 1:46215327-46215349 CAGAAAGAACAGAAAAATACTGG + Intronic
906667799 1:47633854-47633876 TAGAGAGCTCAGAAGGCTTCCGG + Intergenic
906949102 1:50319787-50319809 CAGAGGGAAGTGAAGGCTTCAGG - Intergenic
907601608 1:55776803-55776825 CAGAAAGAAAAAATGGATTCAGG - Intergenic
908954270 1:69602198-69602220 TGGAGAAAACAGAAAGATTCTGG - Intronic
910034291 1:82772003-82772025 GAGATAGAATAGAAGAATTCAGG + Intergenic
911151972 1:94605009-94605031 TAAAGAGAACAGAAGCATTTGGG + Intergenic
911701981 1:100964088-100964110 CAGAGAGATCAGAAGGCTAGAGG + Intronic
911935876 1:103971374-103971396 ACAAGAGAAAAGAAGGATTCTGG - Intergenic
912156620 1:106929013-106929035 CAGAAAGAGGAGATGGATTCAGG + Intergenic
913545112 1:119860363-119860385 CAGTGAGAACAGCAGGGTTCTGG - Intergenic
913992478 1:143627542-143627564 CAGGGAGAACAATAGGGTTCTGG - Intergenic
915716770 1:157951511-157951533 GAGAGGGAACAAAAGGAGTCAGG - Intergenic
915726183 1:158019335-158019357 CAGAAGGACCAGATGGATTCTGG + Intronic
915730143 1:158047633-158047655 CAGGGACAACAGAATGATCCTGG - Intronic
916160714 1:161910071-161910093 CAGAGAGAAAGTAATGATTCAGG + Intronic
916667883 1:166983364-166983386 GAGAGAGAAAAAAAGGATCCAGG - Intronic
917202667 1:172533470-172533492 CAGAGAGCACAGAAAGAGGCAGG - Exonic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
917536212 1:175876524-175876546 CAGGGAGAATAGGAGGAATCAGG - Intergenic
918309472 1:183275490-183275512 CAGAGGCAGCAGAAGGATTTGGG - Intronic
919049091 1:192490599-192490621 CAGAGGTAAGAGAAGAATTCAGG - Intergenic
921235964 1:213130680-213130702 CAGAAATAACAAAAGGCTTCTGG - Intronic
921324737 1:213979555-213979577 CAGAGTGGACCGAAGGATTTTGG - Intergenic
922284851 1:224161752-224161774 CAGACACAACAGAAGAAATCTGG - Exonic
922768784 1:228170841-228170863 GAGAGAGAAGGGAAGGAGTCAGG + Intronic
923947648 1:238906209-238906231 CAAAGAGAACACATGGATACAGG + Intergenic
924432162 1:244006344-244006366 CACAAAGACCAGAAAGATTCTGG + Intergenic
924771300 1:247082239-247082261 CAGTGAGAACACATGGATGCAGG - Intergenic
1062988935 10:1796815-1796837 CAGAGAGAATAAAAAGATGCAGG + Intergenic
1063231111 10:4066591-4066613 CAGAGAGAACAGAACGTTTTGGG + Intergenic
1063323041 10:5070130-5070152 CAGAGAAAACTGCAGAATTCTGG - Intronic
1063870901 10:10416702-10416724 CAGAGACAACAGAAATGTTCTGG + Intergenic
1065395547 10:25232974-25232996 CATTGAAAACAGAAGGATTAAGG + Intronic
1065683331 10:28259619-28259641 GGGAGAGAAGAGAAGGATGCAGG + Intronic
1065879712 10:30028112-30028134 CACAGAGAACTCAAGCATTCTGG - Exonic
1065998316 10:31080510-31080532 TAGAGGCAACAGAAGAATTCAGG - Intergenic
1066565866 10:36721249-36721271 CAGACAGAAAACAGGGATTCTGG + Intergenic
1066713990 10:38266781-38266803 CAGTGAGAACACATGGATGCAGG + Intergenic
1067521751 10:47013031-47013053 CAGATGGAGCAGAATGATTCTGG - Intergenic
1067549455 10:47223599-47223621 CAGAGAGGACAGAAGCTTGCTGG - Intergenic
1067776794 10:49170116-49170138 CAGAGAGGAAGGAAGGACTCAGG + Intronic
1068190702 10:53648874-53648896 CAGACAGAACAGAACGTTTGTGG + Intergenic
1070180148 10:74005607-74005629 CTGAGAGAACAGAAGATTTTTGG + Intronic
1072946493 10:99815140-99815162 CAGGGAGAACACATGGATACAGG - Intronic
1073032731 10:100540507-100540529 CACAGAGAACAGATGTAGTCAGG - Intronic
1074624982 10:115173061-115173083 CTGAGAAAACAGAAGTAATCAGG + Intronic
1076227138 10:128787264-128787286 CACAAAGATCAGATGGATTCAGG + Intergenic
1077559634 11:3251148-3251170 CAGAGAGCTCAGAACGATCCTGG + Intergenic
1077565527 11:3296951-3296973 CAGAGAGCTCAGAACGATCCTGG + Intergenic
1078200542 11:9178597-9178619 TAGAGTGAACATCAGGATTCTGG - Intronic
1078382600 11:10857947-10857969 CAGAGAGGAAAGAAGGATTCGGG + Exonic
1078461015 11:11515443-11515465 CAGAGAGAGCAGGGGGAATCGGG - Intronic
1079098014 11:17523322-17523344 CAGAGAGCACAGAAGGCCCCAGG + Intronic
1079109783 11:17598863-17598885 CAGAAAGAACACTAGGAGTCAGG - Intronic
1079970043 11:27025783-27025805 CAGAGAGAACACATGGACACAGG + Intergenic
1080033828 11:27689919-27689941 CAGAGAGAACACATGGACTCAGG - Intronic
1080287753 11:30635916-30635938 CAGTGAAAACAGAAGTCTTCGGG - Intergenic
1080392558 11:31861658-31861680 CAGGGAAAACAGACCGATTCCGG - Intronic
1080643984 11:34174822-34174844 CAGAGAGAACAGCATGAGTGAGG - Intronic
1081465831 11:43316022-43316044 TTGAGAGAACAGGAGGAATCAGG - Intronic
1081996339 11:47366867-47366889 AACAGAGAACTGAAGGTTTCGGG + Intronic
1082091059 11:48090254-48090276 CAGAAAGAAGGGAAGGATGCAGG - Intronic
1082160320 11:48882676-48882698 CAGAGAGACCAGGGGGAGTCTGG - Intergenic
1082162046 11:48897730-48897752 CAGAGAGACCAGGGGGAGTCTGG + Intergenic
1083518880 11:63288138-63288160 CAGTGAGAACACATGGATGCAGG + Intronic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1086158624 11:83695841-83695863 CAGAGAGCACAGGAGGAATTGGG + Intronic
1086753078 11:90523858-90523880 CAAAGAGAATAGAAGGATGATGG - Intergenic
1088317950 11:108526535-108526557 CCGAGAGTACAGAAGCATCCTGG + Intronic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1089113017 11:116072065-116072087 CAGAGAGAACAGATAGAGGCAGG - Intergenic
1089252329 11:117173929-117173951 CAGTGAAAACAGAAAGCTTCAGG + Intronic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1090772994 11:129938265-129938287 CAGAGGGAACAGAGAGAGTCTGG - Intronic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1092296922 12:7208156-7208178 CAGAAAGAAGACAAGGATCCAGG - Intronic
1092468480 12:8756387-8756409 CAGAGAGATAAGTAGGAATCTGG - Intronic
1095703295 12:45212869-45212891 CAAAGAGAACACATGGATACAGG - Intergenic
1095857433 12:46875390-46875412 CAGTGAAAACAGAAGCTTTCAGG - Intergenic
1095902056 12:47338428-47338450 CAGAGAGATGACAAGGATACTGG - Intergenic
1096086257 12:48867045-48867067 CAGAGAGAAATGAGGGACTCTGG + Intergenic
1096243319 12:49970990-49971012 CAGGGAGAACAGAAGGAAATGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097634677 12:62108181-62108203 CAGTGAGAACACATGGATACAGG - Intronic
1098079630 12:66770450-66770472 TAAAAAGAAAAGAAGGATTCAGG + Intronic
1098193824 12:67978385-67978407 AAGAGAAAACAAAAGGAGTCAGG - Intergenic
1098529126 12:71520664-71520686 CAGTGAGAACAGATGGACACAGG + Intronic
1099231940 12:80036853-80036875 CATACAAAACAGAAGAATTCTGG - Intergenic
1099448455 12:82779291-82779313 TGGAGAGAACTGAAGGATTTAGG + Intronic
1100054776 12:90495743-90495765 CAGAGAGATCTGAAGGAGTCTGG - Intergenic
1100166013 12:91918598-91918620 GGCAGAGAACAGAAGGATTATGG - Intergenic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1101316242 12:103631887-103631909 GAGAGAGAACAGAAGCAATGTGG + Intronic
1101556990 12:105819292-105819314 CACTGACAACAGAAGGAATCAGG - Intergenic
1101885896 12:108661671-108661693 CAGAGGGAACACAGGGCTTCTGG + Intronic
1102336801 12:112088147-112088169 AAGAGAGAAAAGGAGAATTCAGG - Intronic
1102593552 12:113975294-113975316 CAGAAGGGACAGAAGGATTGGGG - Intergenic
1102812188 12:115833843-115833865 AAGAGAAAAGGGAAGGATTCAGG + Intergenic
1104100521 12:125604393-125604415 CAGTGAGAACACATGGATACAGG + Intronic
1104545115 12:129704025-129704047 CATAGAAAACAGAATGATTAGGG + Intronic
1105456246 13:20543843-20543865 CAGAGAGACCAGTGGGGTTCAGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106130902 13:26938624-26938646 CAGTGAGAACACAAGGACACAGG - Intergenic
1106170857 13:27286714-27286736 CAGAGAGAACAGACGGGATGAGG + Intergenic
1106257592 13:28035643-28035665 AAGAGATCACAGAAGGAGTCTGG - Exonic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106738310 13:32611307-32611329 CATAGAGAAGAGAAGGGTTTGGG - Intronic
1107200738 13:37713987-37714009 GAGAGAGAAATGGAGGATTCAGG - Intronic
1107965947 13:45598440-45598462 CAAAGCAAGCAGAAGGATTCTGG - Intronic
1108150329 13:47527140-47527162 TACAGAGAATAAAAGGATTCTGG - Intergenic
1108917721 13:55636374-55636396 CAGTGAGAACAGATGGACACAGG + Intergenic
1109323925 13:60845208-60845230 CATAGACAACAGAAGGATACAGG - Intergenic
1109412715 13:61994394-61994416 CAGAGAACAGAGAATGATTCTGG - Intergenic
1109711873 13:66171998-66172020 GAGAGGGAACACAAGGACTCAGG + Intergenic
1110276698 13:73649018-73649040 CAGAGACTTCAGAAGGATTTTGG + Intergenic
1110337819 13:74352503-74352525 CAGTGAGAACAGATGGACACAGG + Intergenic
1110939215 13:81328405-81328427 CAGTGAGAACACATGGACTCAGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1112323685 13:98429362-98429384 CAGAGAGGTCAGAGGGATCCCGG + Intronic
1112563947 13:100536596-100536618 CAGAGAGAAAAGAGGGAGTTAGG - Intronic
1112735057 13:102407095-102407117 CAGAGAGAAAAGAAGGGGTTGGG - Intergenic
1113671926 13:112181458-112181480 CAGAGGGAACAGTTCGATTCGGG - Intergenic
1114064674 14:19051066-19051088 CAGAGAGGGCAGGGGGATTCAGG + Intergenic
1114097587 14:19348936-19348958 CAGAGAGGGCAGGGGGATTCAGG - Intergenic
1114336348 14:21694596-21694618 CAGAGAGAAAATAGGGCTTCAGG - Intergenic
1114885564 14:26845402-26845424 CTGAGGGAACATAAGGATTCTGG + Intergenic
1116509272 14:45723632-45723654 CAATGAGAACACAAGGATACAGG + Intergenic
1116907490 14:50418346-50418368 CAGTAAGAAAAGGAGGATTCTGG + Intergenic
1118439406 14:65799080-65799102 CAGTGAGGAGAGAAAGATTCAGG - Intergenic
1118440406 14:65806651-65806673 CAGAGAGAAGGGAAGGAGTTGGG - Intergenic
1119641255 14:76316692-76316714 CAGAGAGGAGAGAAGGATAGGGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120285962 14:82501915-82501937 CAGAGAGATCAGAAAGAATATGG - Intergenic
1121083070 14:91124337-91124359 CAGAGAGAAGAGGAGGCATCAGG - Intronic
1121395885 14:93622820-93622842 CTGGGAGAACAGAAAGATCCAGG + Exonic
1121529835 14:94644477-94644499 CAGAGAGCACAGTAGGTTCCAGG - Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1123016791 14:105379543-105379565 CACAGGGCACAGAATGATTCTGG - Intronic
1124167695 15:27342785-27342807 CAGGTAGAACGGAAGGAGTCAGG - Intronic
1124798361 15:32804704-32804726 CAGTGAGAACAGATGGACACAGG - Intronic
1125549826 15:40537065-40537087 GAGCGAGAAGGGAAGGATTCTGG + Intronic
1125899548 15:43332167-43332189 CAGAGAAAACAGAAGCCATCAGG - Intronic
1126355198 15:47788015-47788037 GAGAGAGAACAGGAGGAGACAGG + Intergenic
1126500271 15:49337713-49337735 CAATGAGAACACATGGATTCAGG - Intronic
1127620639 15:60730538-60730560 AAAAGAGAAGAGAAGGATTAAGG - Intronic
1128763656 15:70237148-70237170 CAGGGAGGACTGAAGGATTGTGG + Intergenic
1129614716 15:77089256-77089278 CAGACAGGACAGAGGGATCCTGG + Intergenic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1130644662 15:85713605-85713627 CAGAAAGTACACAAGGATTATGG - Intronic
1131372657 15:91896035-91896057 CATTGAGAACTGAAGGATTTAGG - Intronic
1131730690 15:95277245-95277267 ACTACAGAACAGAAGGATTCTGG + Intergenic
1132087412 15:98919633-98919655 GAGAGAGAAAGGAAGGACTCGGG - Intronic
1134470778 16:14523737-14523759 CAGAAATGACAGAAGGATTAGGG + Intronic
1135021360 16:18965811-18965833 CAGAAAGAACAGAAAGACCCGGG + Intergenic
1135706160 16:24676936-24676958 CAGAGAGAAAAGAAGGCTAGAGG - Intergenic
1136111550 16:28066638-28066660 CAGAGACCACACAAGGACTCAGG + Intergenic
1136751467 16:32639061-32639083 CAGAGAGAACAGTGGGGTTCAGG - Intergenic
1137708898 16:50553080-50553102 CAGAGAGAAACGGAGGATGCTGG + Intronic
1137979160 16:53055166-53055188 CAGAGATAACCGGAGGAGTCGGG + Intronic
1138350803 16:56345342-56345364 CAGGGAGAACAGAGGGCTTGAGG - Exonic
1139584074 16:67890078-67890100 CAGAGAGACCAGTGGGGTTCAGG + Intergenic
1139703691 16:68725752-68725774 CAGGTAGAAAAGTAGGATTCAGG + Intergenic
1140214165 16:72994068-72994090 GATAGGGAACAGAAGAATTCTGG - Intronic
1140713792 16:77703358-77703380 CAGAGGGAACAGTTGGACTCTGG + Intergenic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141270357 16:82534195-82534217 CACAGAGAACTGAAGGAACCAGG + Intergenic
1141486983 16:84347060-84347082 GGGAGAGAACAGAAGGAGACTGG + Intergenic
1142226176 16:88878621-88878643 CTGTGAGAACAGGAGGATCCAGG - Intronic
1203053601 16_KI270728v1_random:898316-898338 CAGAGAGAACAGTGGGGTTCAGG - Intergenic
1143333549 17:6155968-6155990 CAGTGAGAACACATGGATACAGG - Intergenic
1143702819 17:8674234-8674256 CAAAGGGGACAGAAGGACTCAGG + Intergenic
1144223724 17:13123866-13123888 CAGAAAAAACAGAACGACTCTGG + Intergenic
1144353494 17:14422280-14422302 CAGAGATATCTGAAGGATTCTGG - Intergenic
1144409802 17:14989896-14989918 CAGAGAAAATAGAACGAGTCAGG + Intergenic
1144832251 17:18138314-18138336 CAGAGAGGAATGAAGGAGTCAGG - Intronic
1145028642 17:19488086-19488108 CAGAGAGAACTGATTGAATCAGG - Intergenic
1146573720 17:33974133-33974155 CAGAGAGCACAGGAGGTTTGAGG - Intronic
1146693986 17:34895327-34895349 CATAGAGACCAGAAGTATGCAGG - Intergenic
1147121172 17:38335981-38336003 CAGAGGGCAGAGAAGGGTTCTGG + Intronic
1148222371 17:45872063-45872085 CAGAGATAAGAGAATGATCCGGG + Intergenic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1148468410 17:47878438-47878460 GAGAGGGAACTGAAGGAATCAGG - Intergenic
1149886640 17:60347058-60347080 CAAAGAGAACAGAACAAATCTGG + Intronic
1149979916 17:61302187-61302209 CAGAGAGAACAGGAGAACCCTGG - Intronic
1150219013 17:63485351-63485373 CACAGAGACCAGCAAGATTCTGG + Exonic
1151156390 17:72126313-72126335 CGGAGAGAACAAAAGGTTTGGGG - Exonic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1151871650 17:76840832-76840854 CTGAGGGAACAGAGGGAGTCAGG - Intergenic
1153177875 18:2399428-2399450 AAGACAAAACAGAAGGATTCTGG + Intergenic
1153925018 18:9827952-9827974 CAGAAAGGACAGAGGGGTTCAGG + Intronic
1154006288 18:10530255-10530277 GAGAGAGAACAGAAAGACTAAGG - Intronic
1155763192 18:29591687-29591709 CAGTGAGAACACAAGGACACAGG + Intergenic
1156033552 18:32741621-32741643 CAAAAAGAACAGAAGAATTTTGG + Intronic
1157052784 18:44187754-44187776 AAGAGAAAACAGAAGGTTTAGGG + Intergenic
1157197322 18:45630006-45630028 CAGAGAGCATAGAGGGAATCAGG - Intronic
1157331192 18:46705017-46705039 CAGAGAGACCAGAGCCATTCTGG + Intronic
1157912232 18:51627513-51627535 CAGAGAGAATTGTAGGATTAGGG - Intergenic
1158289015 18:55917828-55917850 CAGACAGAAAAGAAGGAATTTGG + Intergenic
1160064253 18:75560392-75560414 GTGGGAGAACTGAAGGATTCTGG + Intergenic
1160250645 18:77200903-77200925 CAGGGAGAACAGCAAGACTCAGG + Intergenic
1162896212 19:13765993-13766015 CAGAGACAACCGAAGCATTGGGG + Exonic
1164965010 19:32475386-32475408 CAGAGAGAACATGATGAGTCTGG - Intronic
1165034642 19:33023923-33023945 CAGAGTGAACCGAAGGTCTCTGG - Intronic
1165752214 19:38267294-38267316 CGGAGAAAACAGAAGCAATCAGG - Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166822192 19:45587484-45587506 AAGAGAGAAAAGAAAAATTCTGG + Intronic
1166900333 19:46056655-46056677 CAGAGAGACGAGGAGGAGTCAGG + Intronic
1167001910 19:46750494-46750516 CAGAGAGATAAGAAGGATGCAGG - Intronic
1167024212 19:46903114-46903136 CAGAAATCACAGATGGATTCAGG + Intergenic
1167311912 19:48741751-48741773 CTGAGAGAAGTGTAGGATTCAGG - Intronic
1167688600 19:50971414-50971436 TACAGAGAACAGAGGGATCCTGG - Intergenic
1202679616 1_KI270711v1_random:40581-40603 CAGTGAGAACAACAGGGTTCTGG - Intergenic
925025885 2:606974-606996 CAGAGAGTCCGGAAGAATTCAGG - Intergenic
925990481 2:9250534-9250556 CAGAGGGTACAAAAGGATACAGG + Intronic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
927750315 2:25663106-25663128 CAGTGAGAACACATGGATACAGG - Intronic
928685896 2:33748572-33748594 CAGTGAGAACACACGGATACAGG + Intergenic
928883448 2:36122706-36122728 CAGTGAGAAAAGATGGATTGGGG + Intergenic
929087493 2:38182901-38182923 CTCAGAGCAGAGAAGGATTCTGG - Intergenic
929277305 2:40040380-40040402 AAGAAAGAACAGAAGTATTGAGG - Intergenic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
930551954 2:52847067-52847089 CAGTGAGAACAGATGGACACAGG - Intergenic
930924634 2:56802257-56802279 CAGAGACAACTGCAGGGTTCTGG - Intergenic
930926622 2:56825976-56825998 TAGAGAAAACAGCTGGATTCTGG - Intergenic
930982615 2:57545962-57545984 GAGATAGAACAGAAGGGCTCTGG + Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
932890533 2:75592586-75592608 AAGAAAGAACAGAAGGAGACTGG - Intergenic
932912956 2:75823903-75823925 CAGAGAGAAAACAAGCAATCTGG + Intergenic
935330573 2:101974622-101974644 TAGAAAGAAGAGAAGGCTTCAGG - Intergenic
936091753 2:109506090-109506112 CAGAGAGAACAGTGGGAGTCAGG + Intergenic
936274757 2:111085177-111085199 CAGAAAAAACAAAAGTATTCAGG + Intronic
936866781 2:117084015-117084037 CAGAGATCACATAAAGATTCAGG + Intergenic
937937041 2:127254456-127254478 CAGACAGAACAAAAGGATGGAGG - Intergenic
938481953 2:131670098-131670120 CAGAGAGGGCAGGGGGATTCAGG + Intergenic
938833352 2:135074540-135074562 CAGAGACAACTGAAGGTTCCTGG - Intronic
939338318 2:140860104-140860126 AAAGGAGAACAGAAAGATTCAGG + Intronic
939446685 2:142319422-142319444 CAGAGAGAAAAAAAGCATTCAGG - Intergenic
940033977 2:149293992-149294014 AAGAGAAAACAGAATGTTTCTGG + Intergenic
940377412 2:152971455-152971477 CAGAGACAACTGCAGGTTTCTGG - Intergenic
941013370 2:160326563-160326585 CAGAGAGAACAGAATGAGACTGG + Intronic
942072493 2:172328500-172328522 CTGCAAGAACAGAAAGATTCTGG - Intergenic
942589828 2:177530759-177530781 CAGAGAAAACAGATGTAGTCTGG + Intronic
942758220 2:179366584-179366606 AAAAGAGAGCAGAAGGATTTTGG - Intergenic
943393720 2:187305437-187305459 CAAAGAGATCAAAAGGATTAAGG + Intergenic
943422815 2:187690241-187690263 CTGAGAGAAGAGAAAGAATCAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
943997361 2:194787140-194787162 CAGTGAGAACACATGGATGCAGG - Intergenic
944977592 2:205073599-205073621 CAAAGAAAACAGAAAGAGTCTGG - Intronic
945004569 2:205390667-205390689 AAGATGGAACAGTAGGATTCAGG + Intronic
945822465 2:214681327-214681349 CATAGAGAACAGAAGGAAATTGG + Intergenic
946538230 2:220655418-220655440 CAGAGAAAAGAGAATAATTCTGG + Intergenic
946549910 2:220789949-220789971 CAGAGTGAAGAGAAGAATTTTGG - Intergenic
946621681 2:221570019-221570041 CAGAGAGAAGAGAATGGTTGCGG - Intronic
947353892 2:229272569-229272591 CAGAGAGAACACAATGTTTGTGG + Intergenic
947705815 2:232274562-232274584 CAAACAGAACAAAAGGATTCTGG - Intronic
948163176 2:235841882-235841904 GAGAGAGAGCAGCAGGATACGGG - Intronic
1170214916 20:13881310-13881332 AAGAGATAAAAGAAGTATTCAGG - Intronic
1172408393 20:34705391-34705413 CAGTGAGGACAGAAGGGGTCAGG - Exonic
1172961618 20:38804581-38804603 CAGTGAAAAAAAAAGGATTCGGG + Intergenic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174891710 20:54402362-54402384 CAGAGAGAAGAAAATGATGCTGG - Intergenic
1175094219 20:56528777-56528799 CAGAGAGACCAAGAGGAATCTGG + Intergenic
1176521348 21:7826871-7826893 CAGAGAGGACAGTCTGATTCTGG - Intronic
1177231448 21:18326060-18326082 CAGAGAGCAAAGAAGGAAACAGG - Intronic
1177503684 21:21993483-21993505 CAGAGAAAACAGAATTATACAGG - Intergenic
1178209881 21:30517503-30517525 CAGAGTGAACAGCATGATTGTGG - Intergenic
1178655368 21:34456883-34456905 CAGAGAGGACAGTCTGATTCTGG - Intergenic
1178909740 21:36664938-36664960 CAGAGAGAACAGGGGCAATCCGG + Intergenic
1179461911 21:41541646-41541668 CAGAGGGAGCAGATGGATTCAGG + Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180483162 22:15773688-15773710 CAGAGAGGGCAGGGGGATTCAGG + Intergenic
1180897372 22:19346719-19346741 GAGAGAGAACAGGAGAAATCTGG - Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181625412 22:24119385-24119407 TGGAGAGTACAGAAGGCTTCCGG + Exonic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1182132584 22:27867786-27867808 CAGACAGAGTTGAAGGATTCAGG - Intronic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1182700436 22:32232870-32232892 AAGAGAGAACATACGGATTCAGG + Intronic
1182822797 22:33233185-33233207 GAGAGAGAACAGAATGAGTGTGG + Intronic
1183942642 22:41304547-41304569 CAATGAGAACACAAGAATTCTGG + Intronic
1184238214 22:43197869-43197891 GGGAGAGAACAGGAGGATCCCGG - Exonic
1184371915 22:44088004-44088026 CAGAGAGATCACAAAGATTCAGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1185066189 22:48632791-48632813 CAGAGAGAATTGAAGGCTCCAGG + Intronic
949610333 3:5697714-5697736 CAGAGGGAACAGAGGGAGTCAGG - Intergenic
951565193 3:24005878-24005900 CAGGGAGAAAGGAAGGATGCAGG - Intergenic
952620582 3:35335780-35335802 CAGAGAGGAGAGAATCATTCAGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953412799 3:42699703-42699725 CAGAGAGCAGAGAAGGGTTCGGG + Intronic
954130508 3:48558375-48558397 CAGAGAGAACCTGAGGATGCAGG - Intronic
955929267 3:64039514-64039536 CACAGAGAACCAAATGATTCTGG - Intergenic
957770479 3:84685725-84685747 AAGAGAGGACAGAAAAATTCTGG - Intergenic
958068391 3:88575949-88575971 CAGAGAGAACAGTAAGTTCCAGG + Intergenic
959645638 3:108697179-108697201 CAGTGAGAACACAAGGACACAGG + Intergenic
960250291 3:115444053-115444075 CAGTGAGAACACATGGACTCAGG - Intergenic
960795722 3:121485040-121485062 CAGAAGGAACAAAAGCATTCTGG - Exonic
963073315 3:141323019-141323041 CAGACAAAACAGAAGGGTACAGG - Intergenic
963231492 3:142912537-142912559 CAGAGAGAAGAAAGGGAGTCAGG + Intergenic
963301318 3:143600223-143600245 CAAAGAGAACACATGGATACAGG - Intronic
963566264 3:146934893-146934915 CAGTGAGAACACATGGACTCAGG + Intergenic
963935633 3:151049748-151049770 CAGAGACAACACAAGGACCCAGG - Intergenic
964238987 3:154569417-154569439 CAGTGAGAACACATGGATACAGG + Intergenic
965587741 3:170334085-170334107 AAGAAAGAAAAGAAAGATTCTGG + Intergenic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
966156883 3:176926224-176926246 CACAGAGAAAGGAGGGATTCTGG + Intergenic
966911057 3:184560558-184560580 CAAGGAGAACAGTAGGTTTCTGG - Intronic
967380039 3:188847459-188847481 CAGAAAGAAGAGAAGGCTTTGGG + Intronic
967422781 3:189292539-189292561 CAGAAATAACAGAAGGATCCTGG + Intronic
967787097 3:193509072-193509094 CAGTGAGAAAAAAAAGATTCGGG + Intronic
968571635 4:1345322-1345344 CCAAGCGAACAGAAGGATGCAGG + Intergenic
970255434 4:14164493-14164515 TGGAGAGAAAAGAAGGACTCAGG - Intergenic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
971760439 4:30758221-30758243 CAGAGAGAACAGGAAGATCCAGG + Intronic
972315642 4:37923150-37923172 CAGTGAGAACACATGGACTCAGG - Intronic
972347890 4:38208895-38208917 CAGAGAGATGAGAAGGATTTGGG - Intergenic
972956716 4:44401296-44401318 CAGAGAGTTCTAAAGGATTCAGG - Intronic
973250028 4:48050833-48050855 CAGAGAGAACCTCAGGACTCTGG + Intergenic
973623785 4:52751514-52751536 CAGAGCGGACAGCCGGATTCAGG + Exonic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
975304460 4:72833260-72833282 CAGTGAGAACACATGGATGCTGG + Intergenic
976252600 4:83068355-83068377 AAAAGAGAACAGAAAGCTTCTGG - Intronic
976530946 4:86151232-86151254 CTGAGAAAACAGATGGACTCAGG - Intronic
977404271 4:96576085-96576107 CAGAGAGAACACATGGACACAGG - Intergenic
977924722 4:102687042-102687064 CAGAAAGAAGAGAAGGTTTGGGG - Intronic
978871804 4:113587567-113587589 TAAAGAGAACTGAAGGATTGAGG + Intronic
979373876 4:119921321-119921343 AAGAGAGAATAACAGGATTCAGG - Intergenic
980989564 4:139727783-139727805 GAGGGAAAACAGAAGGATTTGGG - Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981675845 4:147342179-147342201 GAGGGAGAACAGAATGATTTGGG - Intergenic
981839676 4:149096398-149096420 CAAAGAGAAGAGGAGGAGTCTGG - Intergenic
982027428 4:151264575-151264597 CAGAGAGTACAGGAAGAGTCTGG + Intronic
982066123 4:151656206-151656228 CAGGAAGAACACAAGGCTTCAGG - Intronic
982136395 4:152277759-152277781 CAGAGAGAAGAGGGGGTTTCAGG + Intergenic
982206291 4:152999486-152999508 CAGATAGGACAGACGGTTTCCGG - Intergenic
982925235 4:161328627-161328649 AACAGACAACAGAAGGATTCTGG - Intergenic
982938529 4:161518341-161518363 CAGAGAGAACAGGAGCTTTAAGG + Intronic
983325523 4:166250948-166250970 CAAAGAGAACACAAGGACACAGG + Intergenic
983746626 4:171208536-171208558 CAATGAGAACAGATGGACTCAGG - Intergenic
984218081 4:176939622-176939644 CAGAGAGAAGAGCAGTATGCTGG - Intergenic
984719159 4:182954061-182954083 GAGAGAGACTAGAAAGATTCAGG + Intergenic
985107353 4:186511882-186511904 CAGAGACACAAGAAGGCTTCTGG + Intronic
985227686 4:187780431-187780453 CAGAGAGAACAAACGGATCAGGG + Intergenic
985921211 5:2977289-2977311 CAAAGAGAACAAAAGGAGACTGG - Intergenic
986670704 5:10140418-10140440 CAGAGAGAAGACAGGGACTCAGG - Intergenic
988684525 5:33514333-33514355 CAGAGACGAGAGGAGGATTCAGG + Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
990516736 5:56537262-56537284 CACAGAGAAGAGATGGTTTCTGG - Intronic
990818095 5:59807685-59807707 CAGATAGAACCGAAACATTCAGG + Intronic
990995711 5:61730392-61730414 GAGAGAGAGCAGAAGGTGTCAGG + Intronic
991464076 5:66891679-66891701 AAGAGAGAACAGACGTAGTCAGG - Intronic
991929897 5:71743984-71744006 AAGAGATAACAGAAAGATTGAGG - Intergenic
991948564 5:71925891-71925913 GAGAGAGAACAGAGAGAGTCAGG + Intergenic
993160053 5:84278803-84278825 CAAAGAGAACAGGAGGAGTCAGG - Intronic
993534886 5:89070933-89070955 CAGAGAGAACACATGGACACGGG - Intergenic
994111412 5:96008784-96008806 CAGAGAGAGCAGAAGAATCCTGG + Intergenic
994199520 5:96956824-96956846 CACAGAGAAAAGAAAGATTGAGG - Intronic
995449666 5:112286697-112286719 GAAAGAGAACAGAAGGTTGCTGG - Intronic
996160963 5:120164251-120164273 CAGAGAGAGCATTAGTATTCTGG + Intergenic
998665532 5:144292848-144292870 CAGAGAGAGCGCTAGGATTCCGG + Intronic
999692230 5:154157998-154158020 CAGAGAGAACAGCAAGATCTGGG + Intronic
1000290432 5:159865053-159865075 CAGAGAAAAGGGGAGGATTCGGG + Intergenic
1000663894 5:163970829-163970851 CAGTGAGAACACATGGATACAGG - Intergenic
1001270796 5:170310077-170310099 CAGAAAGCACAGAAGGGGTCAGG - Intergenic
1001914471 5:175548036-175548058 AAGGGAGAACAAAAGGATTGGGG - Intergenic
1002690753 5:181048342-181048364 CACAGAGAACAGAAGAATGTCGG + Intronic
1004473136 6:15946875-15946897 CAGAGAGAGCAGATGCATTAGGG + Intergenic
1005023115 6:21436546-21436568 CAGGGAGAAGAGAAGAATTGTGG - Intergenic
1006339778 6:33440507-33440529 CAGAGGGAACAGACAGATTAGGG - Intronic
1007894365 6:45336105-45336127 CTGGGAGAATAGAAGAATTCTGG - Intronic
1008308742 6:49938166-49938188 AAGAGAGAAAAGAATTATTCTGG + Intergenic
1009581281 6:65537144-65537166 CAGTGAGAACACACGGATACAGG + Intronic
1010425616 6:75725840-75725862 CTGAGACAAAAGAAAGATTCTGG - Intergenic
1010496604 6:76540034-76540056 TTGAGAGAACAAAAGTATTCAGG + Intergenic
1010816251 6:80361131-80361153 CAGAGAGAAAAGAATGAAGCTGG - Intergenic
1011002686 6:82608513-82608535 CAGAGAGGACAGATGGAGTCAGG - Intergenic
1011512064 6:88112437-88112459 CTGAGACAACAGAAGGGTTTTGG - Intergenic
1011570943 6:88733962-88733984 CAGAGAGAAAAAAAAGATACAGG + Intronic
1012043790 6:94243265-94243287 CAATGAGAACACATGGATTCAGG + Intergenic
1012665630 6:101964805-101964827 CAGGGAGAACACAATGAGTCAGG + Intronic
1013111252 6:107067185-107067207 CAGAGATAACAGAAACAATCTGG - Exonic
1013405704 6:109841015-109841037 CAAAGAAAACAAAAGGAATCCGG + Intergenic
1014086561 6:117352735-117352757 CAGAGAGAACAACAGGACGCAGG + Intronic
1014215962 6:118753002-118753024 GAGAGAGAAAAGAAGGATTGAGG - Intergenic
1014429742 6:121353948-121353970 CAGAGAGAAGAGAAGCTTTGGGG + Intergenic
1015276570 6:131388544-131388566 CAGAGAAAACAGAAGTCCTCGGG + Intergenic
1015938030 6:138421915-138421937 CAGTGAGACCAGAAGGTCTCTGG - Exonic
1016834134 6:148460054-148460076 CAGACAGAACAAAAGGAGGCAGG + Intronic
1017487521 6:154916971-154916993 CATAGAGATCAGAAGGATATAGG + Intronic
1018152560 6:160954228-160954250 CAGTGAGAACACATGGATACAGG + Intergenic
1018224670 6:161616605-161616627 CAGTGAGAACATATGGATACAGG - Intronic
1018777611 6:167032012-167032034 CAGAGTTAACATAAGGATTCAGG - Intronic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1021231493 7:18090775-18090797 CAAAGTGAACAGAAGGTTTATGG + Intronic
1021586854 7:22218127-22218149 CAGTGAGAACACAAGGACACAGG + Intronic
1021784592 7:24139366-24139388 TACAGAGAAAAGAAGGCTTCAGG - Intergenic
1022365820 7:29715072-29715094 CAGTGAGAACAGATGGACACAGG + Intergenic
1023291652 7:38674381-38674403 AAGAAACAACAGAAGGAATCTGG - Intergenic
1024009198 7:45253318-45253340 GAGAGAGAAGAGAAGGAGACAGG - Intergenic
1024722611 7:52154503-52154525 CAGAGAGAAAAGATATATTCAGG - Intergenic
1025888940 7:65627499-65627521 CAGAGAGAAAAAATGAATTCAGG + Intergenic
1027827404 7:83134365-83134387 CAGAGAGGACAGGTTGATTCTGG + Exonic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029042015 7:97586255-97586277 CAAAGAGAACACATGGATACAGG + Intergenic
1029290463 7:99498733-99498755 GAGAGTGCGCAGAAGGATTCCGG - Exonic
1029827867 7:103219756-103219778 CAGTGAGAACAGATGGACACAGG - Intergenic
1030248185 7:107409156-107409178 CAGAGAGAGCACAAAGATTAAGG + Intronic
1030362665 7:108611098-108611120 GAGAGAAAGCACAAGGATTCTGG - Intergenic
1030396726 7:108995388-108995410 CAGAGAGACCAAAAAGAATCTGG - Intergenic
1031853511 7:126894466-126894488 CAGAGAGAAAAAATGAATTCAGG - Intronic
1031866547 7:127043562-127043584 CAATGAGAACACATGGATTCAGG + Intronic
1032109918 7:129067175-129067197 CAGAGAGACCAGTGGGGTTCAGG + Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1035392432 7:158514161-158514183 CAGACAGAAGAGAAAGATTAGGG - Intronic
1036129807 8:6098563-6098585 CAGAGAGAGCAGAAGCACCCAGG - Intergenic
1037026142 8:14040565-14040587 CAGAGAGAATAGGCAGATTCAGG + Intergenic
1037403422 8:18516503-18516525 TATAGAGAACAGTAGAATTCAGG + Intergenic
1037880014 8:22568667-22568689 CAAAGAGAACGTGAGGATTCTGG + Intronic
1038362046 8:26889941-26889963 CAGAGAGCAGAGCAGGATGCAGG + Intergenic
1038375996 8:27041022-27041044 CCTACATAACAGAAGGATTCTGG - Intergenic
1039250627 8:35660482-35660504 CAGAGAGCACAGAATGCTCCAGG - Intronic
1040352446 8:46582642-46582664 CAGAAAGAGCAGAAGTATACTGG - Intergenic
1040737449 8:50526167-50526189 CAGAGAACACAGAAGAGTTCAGG - Intronic
1041732951 8:61081246-61081268 AAGAGAGAGCAGAAGGAATGAGG + Intronic
1042819158 8:72911265-72911287 CAGAGAGAACACACAGATTTGGG + Intronic
1043726157 8:83613572-83613594 CAGACAGAATAGAATGATTTTGG - Intergenic
1043823731 8:84900170-84900192 GGAAGAGAACAGAAAGATTCTGG + Intronic
1043974366 8:86568205-86568227 CAGAGGCAGCGGAAGGATTCTGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045752861 8:105507058-105507080 TAGAGAGAACAGATGGATCTAGG + Intronic
1046137359 8:110045967-110045989 CAGAGAAAAAAGAATGGTTCTGG + Intergenic
1046273564 8:111927230-111927252 GAGAGACCACAGAAGGATTATGG + Intergenic
1047515086 8:125546998-125547020 GAGAGAGCACAGATGGTTTCAGG + Intergenic
1048846859 8:138610441-138610463 CTGAGCGAGGAGAAGGATTCTGG - Intronic
1049023107 8:139971049-139971071 CAGAGAAAAGAGGTGGATTCCGG - Intronic
1049115896 8:140687364-140687386 AAGAGTGAACAGAAGTTTTCCGG - Intronic
1049425090 8:142534380-142534402 CAGAGTGAACAGAGGGGCTCTGG + Intronic
1049523249 8:143106017-143106039 CAGTGAGAACACAAGGACACAGG + Intergenic
1050444966 9:5711355-5711377 CAGACAAAACAGAAGCATTTAGG - Intronic
1051005792 9:12342063-12342085 CAGTGAGAACACAAGGACACAGG + Intergenic
1051347367 9:16164352-16164374 CAAAAAGAAGAGAAAGATTCTGG + Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051569382 9:18538352-18538374 CAGAGAGAACAGAATGATCATGG + Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1052354046 9:27486197-27486219 CACAGAGACTAGAAGGATTCAGG + Intronic
1052379927 9:27758941-27758963 AAGAGAGATCAGAAGGCTTAAGG + Intergenic
1052799866 9:32957041-32957063 CAGTGAGAACAGAAGTCTTTGGG - Intergenic
1056226304 9:84498704-84498726 CAGAGAAAACAGCAGAGTTCAGG + Intergenic
1056282511 9:85055689-85055711 CAGAGGCATCAGAAGGGTTCAGG + Intergenic
1057710705 9:97440551-97440573 CACAGAGAAGAGAAGGCTCCAGG - Intronic
1057796908 9:98164404-98164426 CAGAGACCCCATAAGGATTCTGG - Intronic
1059282329 9:113145562-113145584 CAGAGAGAACAGAAGGGACAGGG + Intergenic
1060338900 9:122755269-122755291 CAGAGAGGAGAGAAGGACTGGGG - Intergenic
1060540486 9:124426820-124426842 CAGAGGGGACAGAAGGGTTCTGG - Intergenic
1060957318 9:127651762-127651784 CAGAGAGTACAGAATGCTCCTGG + Intronic
1203493606 Un_GL000224v1:129982-130004 CAGAGAGTACAGGAGTGTTCTGG - Intergenic
1203506227 Un_KI270741v1:71857-71879 CAGAGAGTACAGGAGTGTTCTGG - Intergenic
1186570419 X:10709446-10709468 GAGACAGAACAGCAGGCTTCAGG + Intronic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1189198664 X:39173230-39173252 CAGAGAGGCGAGAAGAATTCTGG + Intergenic
1190412630 X:50152009-50152031 CAAAGAGAACAGATGGACACAGG + Intergenic
1190876928 X:54466600-54466622 TGGAGATTACAGAAGGATTCAGG - Intronic
1190924552 X:54890878-54890900 GAGAGAGAACATAAGGAATTTGG - Intergenic
1191043577 X:56112279-56112301 CAGTGAGAACACATGGATACAGG + Intergenic
1191159000 X:57307172-57307194 CAGAGAGAATAGAAAGATGAAGG - Intronic
1191812498 X:65204038-65204060 GAGAGAGAACACAATGATTGTGG - Intergenic
1193181197 X:78458939-78458961 CAGAGAGAAGAGACAGATTCAGG - Intergenic
1193259836 X:79392476-79392498 CAGTGAGAACACATGGATACAGG + Intergenic
1194590536 X:95795099-95795121 AAGAGTGAAATGAAGGATTCAGG + Intergenic
1195549730 X:106153963-106153985 CAATGAGAACACATGGATTCAGG + Intergenic
1196041867 X:111213458-111213480 GAGAGAGATGAGAAGGACTCAGG + Intronic
1196169455 X:112571619-112571641 CAGGGAGAACTGAAGAATTTAGG + Intergenic
1196795107 X:119495974-119495996 CCGAGACAACAGCTGGATTCCGG - Intergenic
1198178629 X:134182144-134182166 GTAAGTGAACAGAAGGATTCTGG + Intergenic
1198366857 X:135949288-135949310 CACAGAGAACAAAAAGAATCTGG + Intergenic
1198505508 X:137297164-137297186 CAGAGAGATAAGAAAGATTTGGG - Intergenic
1199097799 X:143762500-143762522 CAAAGAGAACACATGGACTCAGG - Intergenic
1200510654 Y:4074808-4074830 CAGTGAGAACACATGGATGCAGG - Intergenic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1201358328 Y:13119133-13119155 CAAAGAGAACAGATGGACACAGG - Intergenic