ID: 1174482541

View in Genome Browser
Species Human (GRCh38)
Location 20:50841759-50841781
Sequence CCATCTTGACGAAGGCCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174482541_1174482551 27 Left 1174482541 20:50841759-50841781 CCCTCAGGCCTTCGTCAAGATGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1174482551 20:50841809-50841831 CAGACGTGCTTCAGGCTGAGCGG 0: 1
1: 0
2: 1
3: 10
4: 142
1174482541_1174482552 28 Left 1174482541 20:50841759-50841781 CCCTCAGGCCTTCGTCAAGATGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1174482552 20:50841810-50841832 AGACGTGCTTCAGGCTGAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 106
1174482541_1174482550 19 Left 1174482541 20:50841759-50841781 CCCTCAGGCCTTCGTCAAGATGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1174482550 20:50841801-50841823 CCTGGAAGCAGACGTGCTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 143
1174482541_1174482546 1 Left 1174482541 20:50841759-50841781 CCCTCAGGCCTTCGTCAAGATGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1174482546 20:50841783-50841805 TGGACACCACGTCGCCTTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174482541 Original CRISPR CCATCTTGACGAAGGCCTGA GGG (reversed) Exonic