ID: 1174484250

View in Genome Browser
Species Human (GRCh38)
Location 20:50851402-50851424
Sequence GGTCTTTGGTGGAGTGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174484229_1174484250 28 Left 1174484229 20:50851351-50851373 CCAGCCCCCTCCCCACGGCTCCC 0: 1
1: 2
2: 19
3: 232
4: 2130
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484233_1174484250 23 Left 1174484233 20:50851356-50851378 CCCCTCCCCACGGCTCCCAGGGA 0: 1
1: 0
2: 8
3: 56
4: 442
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484245_1174484250 -3 Left 1174484245 20:50851382-50851404 CCCGGGTTCGTTTCCTTCAAGGT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484236_1174484250 18 Left 1174484236 20:50851361-50851383 CCCCACGGCTCCCAGGGACCTCC 0: 1
1: 0
2: 3
3: 30
4: 289
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484243_1174484250 0 Left 1174484243 20:50851379-50851401 CCTCCCGGGTTCGTTTCCTTCAA 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484238_1174484250 16 Left 1174484238 20:50851363-50851385 CCACGGCTCCCAGGGACCTCCCG 0: 1
1: 0
2: 0
3: 21
4: 299
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484242_1174484250 7 Left 1174484242 20:50851372-50851394 CCAGGGACCTCCCGGGTTCGTTT 0: 1
1: 0
2: 1
3: 4
4: 38
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484235_1174484250 21 Left 1174484235 20:50851358-50851380 CCTCCCCACGGCTCCCAGGGACC 0: 1
1: 0
2: 3
3: 53
4: 373
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484231_1174484250 24 Left 1174484231 20:50851355-50851377 CCCCCTCCCCACGGCTCCCAGGG 0: 1
1: 1
2: 12
3: 78
4: 707
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484246_1174484250 -4 Left 1174484246 20:50851383-50851405 CCGGGTTCGTTTCCTTCAAGGTC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484234_1174484250 22 Left 1174484234 20:50851357-50851379 CCCTCCCCACGGCTCCCAGGGAC 0: 1
1: 0
2: 2
3: 45
4: 372
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484241_1174484250 8 Left 1174484241 20:50851371-50851393 CCCAGGGACCTCCCGGGTTCGTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1174484237_1174484250 17 Left 1174484237 20:50851362-50851384 CCCACGGCTCCCAGGGACCTCCC 0: 1
1: 0
2: 1
3: 22
4: 281
Right 1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174484250 Original CRISPR GGTCTTTGGTGGAGTGCTAT AGG Intronic
900639310 1:3681278-3681300 GGTCCTCGGTGAGGTGCTATGGG - Intronic
906258439 1:44368084-44368106 GGTCTGTGGTGGAGGGGAATAGG + Intergenic
907193337 1:52666748-52666770 GGTCTTTACTGGAAAGCTATTGG + Intronic
907920505 1:58906831-58906853 CATCTGTGGTGGTGTGCTATGGG - Intergenic
909424484 1:75506722-75506744 GGTTTTTGGTGGAGTCTTTTGGG + Intronic
909611631 1:77557174-77557196 CATCATTGATGGAGTGCTATGGG - Intronic
923389325 1:233498330-233498352 GGTCCTTGGTGGGGTGCAGTGGG + Intergenic
1063389063 10:5637083-5637105 GGTCTGTTTTGGAGAGCTATTGG - Intergenic
1066011086 10:31193861-31193883 GGTCTCTGATAGAGTGCTATTGG - Intergenic
1068686887 10:59879761-59879783 GGGCTTTGGTTGAGTAATATTGG - Intronic
1070400353 10:76047841-76047863 GCTCTATGGTGGAGAGGTATGGG - Intronic
1077264422 11:1641950-1641972 GGTCTGGGGTGGAGTGGTCTGGG - Intergenic
1077264510 11:1642217-1642239 GGTCTGGGGTGGAGTGGTCTTGG - Intergenic
1083719986 11:64599284-64599306 GGTCTTTGCTGGATGGCCATGGG - Intronic
1085031356 11:73272773-73272795 GGTCTTGGTTGGAGTGCAAATGG + Intronic
1090354120 11:126128112-126128134 TGTCTCTGGGGGAGTGCTCTTGG + Intergenic
1091451579 12:575514-575536 GGGCCTTGGTGGAGTGCATTTGG - Intronic
1091763177 12:3101160-3101182 TGTCTTTTATGGAGTACTATTGG + Intronic
1094357646 12:29595490-29595512 GGACTGTGGGGCAGTGCTATGGG - Intronic
1097407354 12:59206324-59206346 GCTTTTTGGTGGAGTGTTTTGGG - Intergenic
1098060754 12:66559433-66559455 GGTTTTTGGTGGAGTCTTAAGGG - Intronic
1101241832 12:102846852-102846874 GGTGGATGGTGGAGTGCTATAGG - Intronic
1108173210 13:47765482-47765504 CCTCATTGGTAGAGTGCTATGGG + Intergenic
1112238296 13:97656179-97656201 GGTTCCTGGTGGAGTGCCATAGG - Intergenic
1115047760 14:29018564-29018586 GGTTTTGGGTTGAGTGCTTTGGG + Intergenic
1119912013 14:78358173-78358195 AGTGTTTTGTGGAGTGCTGTAGG + Intronic
1120532476 14:85648741-85648763 CATCCTTGGTGGAGTCCTATGGG - Exonic
1124381404 15:29170548-29170570 GGTCTTTGTTGGAATTCCATTGG - Intronic
1128263862 15:66252062-66252084 TCTCTTTGTTGGAGTGCTGTCGG - Intronic
1128316447 15:66662252-66662274 GGTCTTTGGTGGGGTATGATGGG - Intronic
1131173456 15:90194578-90194600 GGTCTCTAGTGGCGTGCCATTGG + Intronic
1132234698 15:100210550-100210572 GGTCTCTGATGTAGTGCTTTAGG - Intronic
1140709393 16:77662829-77662851 TGTCTTTGGTGGAGTTACATGGG + Intergenic
1146220284 17:31012609-31012631 GCTCTTGGCTGGAGTGCAATGGG + Intergenic
1146364709 17:32213423-32213445 GTTCTCTGGTGGAATACTATAGG - Intronic
1147652711 17:42071489-42071511 GGTCTTTGGGGGAGTGTCAGTGG - Intergenic
1149813012 17:59696336-59696358 GGTCATTGGTGGAGTATTGTGGG - Intronic
1165797237 19:38526328-38526350 GGTCCTGGGGGGAGGGCTATAGG - Intronic
1166575717 19:43835669-43835691 GGTCTATGGAGAAGTTCTATAGG - Intronic
931817726 2:65921223-65921245 GGTCCAAGGGGGAGTGCTATGGG - Intergenic
941535087 2:166712436-166712458 GGTTTTTGGTGGAGTCTTGTGGG + Intergenic
943015730 2:182508298-182508320 GGTCTTTGATGGAATGTTTTAGG - Intronic
948077391 2:235175589-235175611 GGTCTTGGGTAGAGAGTTATGGG - Intergenic
948929426 2:241122628-241122650 GGTTTTTGGAGGAGTCCTCTAGG - Intronic
1173963607 20:47093953-47093975 TGTCTTTTGGGGAGGGCTATTGG - Intronic
1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG + Intronic
1175007446 20:55700444-55700466 GGTGTTTGGAGGAGTGTAATTGG + Intergenic
1177846203 21:26290246-26290268 GTTTTTTGGAGGAGTGCTCTTGG + Intergenic
955948006 3:64213859-64213881 GGTGTTTGGTGAAGGGCTTTGGG - Intronic
957172502 3:76756697-76756719 GGTCTTAGGTGGAGTACTCCCGG - Intronic
959115849 3:102177405-102177427 GTTCTGTGGTGGAATGCAATGGG + Intronic
961971326 3:130971714-130971736 GGTACTTGGGGGAGTTCTATTGG - Intronic
963892150 3:150647760-150647782 GGTCTTTGGGGGAGTGGTGTGGG + Intergenic
968473919 4:794183-794205 GCTTTTTGGTTGAGTGCTCTGGG + Intronic
971475544 4:27068497-27068519 TGCCTTAGGTGGAGTGCTAAGGG + Intergenic
973193412 4:47412752-47412774 GGTCTGTGGTGAAATGCAATGGG + Intronic
981101819 4:140837441-140837463 CCTCATTGGTGGAGTACTATGGG + Intergenic
981664143 4:147202493-147202515 GGTCTTTGGTGGAGAACGTTAGG - Intergenic
985861963 5:2478199-2478221 GGTCGTTTGTAGAGAGCTATAGG - Intergenic
986382732 5:7202952-7202974 GGTCCTTGGTGGAGAACCATTGG + Intergenic
988935213 5:36075345-36075367 GGTATTTTGTGGGGTTCTATTGG + Intergenic
989765924 5:45083386-45083408 GTTTTTTGGTGGAGTGTTCTGGG - Intergenic
990656816 5:57966087-57966109 GGTATTTGGTGGATTTCTTTTGG - Intergenic
991214690 5:64148834-64148856 TGTCTGTGGTGGAGTGCCAGAGG + Intergenic
991561155 5:67955026-67955048 GGTTTTTGGTGCAATGATATAGG + Intergenic
993303683 5:86247986-86248008 GGTCTTTGATGGAATGTTTTAGG + Intergenic
998550206 5:143070013-143070035 GGTGTTTGGTGGAGTGCCGATGG + Intronic
999680489 5:154054749-154054771 GGTCTTAGGTATGGTGCTATAGG + Exonic
1003198111 6:3932854-3932876 CATCTTTTGTGGGGTGCTATGGG + Intergenic
1004916211 6:20334500-20334522 GGTCCTTGGTTCATTGCTATTGG + Intergenic
1005707273 6:28468472-28468494 GGTATGAGGTGGAATGCTATTGG + Intergenic
1008683262 6:53896946-53896968 AGTATTTGGGGGAGTTCTATAGG + Intronic
1014930453 6:127329302-127329324 GGTATTTGGTGGAGTTGGATTGG - Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031651513 7:124296608-124296630 GGCTTTTTGTGGAATGCTATGGG + Intergenic
1035549160 8:506891-506913 AGTCTGTGGTGAAGTGCAATGGG + Intronic
1041356340 8:57004684-57004706 GCTTTTTGGTGGAGTGCTTAGGG + Intergenic
1043497635 8:80820338-80820360 GTCCTTTGGTTCAGTGCTATTGG + Intronic
1046476586 8:114752540-114752562 TGTCATTGGTTGAGTGCTTTTGG + Intergenic
1047038485 8:120966104-120966126 GGTCTTTGGTGGCATCCTGTGGG + Intergenic
1047155874 8:122317844-122317866 CGCTTTTGGTGGAGTGCAATTGG + Intergenic
1048823828 8:138403736-138403758 GGTCTTTGGGGGAGGGGAATGGG - Intronic
1053483619 9:38435171-38435193 AGTCGGTAGTGGAGTGCTATAGG + Intergenic
1053592426 9:39527733-39527755 CCTCATTGGTTGAGTGCTATGGG - Intergenic
1053850274 9:42283075-42283097 CCTCATTGGTTGAGTGCTATGGG - Intergenic
1054573875 9:66837546-66837568 CCTCATTGGTTGAGTGCTATGGG + Intergenic
1054985056 9:71252327-71252349 GGTTTTTCGTGGACTGTTATTGG + Intronic
1057013202 9:91626400-91626422 GTTGTTGGGTGGAGTTCTATAGG + Intronic
1062162172 9:135086847-135086869 GGTCTGTGGTGGAGGGGTGTGGG - Intronic
1195883912 X:109620671-109620693 TTTCTTTGGAGGAGTGCTCTTGG - Intergenic
1199153088 X:144512890-144512912 GGCTTTTGATGGAGTGCAATGGG + Intergenic
1202067918 Y:20960089-20960111 GGTCTTTGGTGGAGATCCAGTGG + Intergenic
1202126611 Y:21574069-21574091 GGTCTTTGGTGGGGAACTTTTGG - Intergenic