ID: 1174485194

View in Genome Browser
Species Human (GRCh38)
Location 20:50856575-50856597
Sequence CACAAAAGGGACAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174485194_1174485202 16 Left 1174485194 20:50856575-50856597 CCAGCCTCCTTGTCCCTTTTGTG 0: 1
1: 0
2: 3
3: 44
4: 398
Right 1174485202 20:50856614-50856636 TGGCCTAGACCTGGCTCCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 187
1174485194_1174485200 -4 Left 1174485194 20:50856575-50856597 CCAGCCTCCTTGTCCCTTTTGTG 0: 1
1: 0
2: 3
3: 44
4: 398
Right 1174485200 20:50856594-50856616 TGTGTCTGGTAGCTCTTTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1174485194_1174485205 23 Left 1174485194 20:50856575-50856597 CCAGCCTCCTTGTCCCTTTTGTG 0: 1
1: 0
2: 3
3: 44
4: 398
Right 1174485205 20:50856621-50856643 GACCTGGCTCCAGAGGCCTTGGG 0: 1
1: 0
2: 3
3: 31
4: 308
1174485194_1174485204 22 Left 1174485194 20:50856575-50856597 CCAGCCTCCTTGTCCCTTTTGTG 0: 1
1: 0
2: 3
3: 44
4: 398
Right 1174485204 20:50856620-50856642 AGACCTGGCTCCAGAGGCCTTGG 0: 1
1: 0
2: 4
3: 35
4: 339
1174485194_1174485201 7 Left 1174485194 20:50856575-50856597 CCAGCCTCCTTGTCCCTTTTGTG 0: 1
1: 0
2: 3
3: 44
4: 398
Right 1174485201 20:50856605-50856627 GCTCTTTGCTGGCCTAGACCTGG 0: 1
1: 0
2: 2
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174485194 Original CRISPR CACAAAAGGGACAAGGAGGC TGG (reversed) Intronic
900720166 1:4170849-4170871 CCAGGAAGGGACAAGGAGGCAGG - Intergenic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
901158311 1:7155306-7155328 AGCAAAAGGGACAGGTAGGCAGG - Intronic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902185814 1:14724575-14724597 CACAAAACGGAGAAGGAACCAGG - Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
903047747 1:20576890-20576912 GAAAAAAGGGACAAGTAGGCAGG - Intergenic
903774905 1:25786774-25786796 GACAAAAGTGAAAAGGAGGATGG - Intergenic
903828207 1:26159921-26159943 TAAAAAAGGGACAAGGACCCTGG + Intronic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904254166 1:29244026-29244048 CTCAGAAGGGACAAGGAGAAAGG + Intronic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908276754 1:62481036-62481058 AACAAAAGGGACAAAGAAGATGG + Intronic
910571025 1:88703063-88703085 GAGAAAAGGGACAAGGAGTGCGG - Intronic
911005599 1:93218806-93218828 CATAAAAGTGCAAAGGAGGCTGG - Intronic
911952243 1:104189288-104189310 CTCGAGAGGGACAAGGAGACAGG + Intergenic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912839454 1:113026049-113026071 AACAAAAATGACAAGGGGGCCGG + Intergenic
913705079 1:121413121-121413143 TACAAAAGTTACAAGGAGCCGGG + Intergenic
914465041 1:147920048-147920070 CCCAAAAGGGAAAGGGAAGCTGG + Intergenic
915283736 1:154839816-154839838 CACAGACGGGACAAGGTGCCAGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
917698469 1:177555263-177555285 CCCAAAAGGGGAAAAGAGGCAGG + Intergenic
917796283 1:178535003-178535025 CAAAAATGGAACATGGAGGCCGG + Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
919624345 1:199896552-199896574 CACAAAAGGGAGGAAAAGGCTGG - Intergenic
919801560 1:201357555-201357577 CCCAAAATGGACAGGGAGGCAGG - Intergenic
920099468 1:203507899-203507921 GACAAAAGAGAAAAGGAAGCAGG - Intronic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
924223059 1:241897990-241898012 CACAGAAGTAACCAGGAGGCTGG - Intergenic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924925781 1:248678187-248678209 GACAAAAAGGACAATAAGGCAGG + Intergenic
1063945194 10:11169236-11169258 TCTAAAAGGGACAAGAAGGCAGG + Intronic
1065053857 10:21823024-21823046 CAGAAAAGGGATAAGAATGCAGG + Intronic
1065668467 10:28087795-28087817 CACAGAAGGGACAGTGAGGTGGG + Intronic
1065679293 10:28212617-28212639 CACAGAAGAGAAGAGGAGGCAGG + Intronic
1066249335 10:33617925-33617947 CACAGAGGGGACAGGGCGGCGGG - Intergenic
1066351448 10:34640877-34640899 GAAAAAAGGGACAGGGAGGGAGG + Intronic
1066441744 10:35446046-35446068 CACAAAATGTTTAAGGAGGCAGG - Intronic
1068223340 10:54072542-54072564 CACAGAAGAGACATGAAGGCAGG + Intronic
1070168598 10:73915816-73915838 TACAAAACTGAGAAGGAGGCTGG + Intronic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1071516503 10:86301148-86301170 CAGAAAAGAGACAATGAGGCCGG + Intronic
1071777560 10:88806254-88806276 CTCAAAAGAGCCAAGGAGGTAGG - Intronic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072147190 10:92652104-92652126 CAAAAAAGGTACAAGCAGCCAGG - Intronic
1072158008 10:92741335-92741357 GAGAAAAGTTACAAGGAGGCTGG + Intergenic
1072163948 10:92793782-92793804 CAGAGAAGAGACAAGGAGCCAGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073243899 10:102075907-102075929 CTCCAAGGGGTCAAGGAGGCAGG + Intergenic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1075247615 10:120837741-120837763 GACAAAAGGGAGGAGGTGGCAGG + Intergenic
1076100647 10:127774941-127774963 CACAAAAAGTGCAAGGAGTCTGG - Intergenic
1076480847 10:130784425-130784447 CACAAAAGGAAGACGGGGGCAGG + Intergenic
1076495253 10:130893031-130893053 CACAAAGGAGACAAGGACGATGG - Intergenic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1077599452 11:3563820-3563842 CACACAAGGAATAAGGAGGGGGG + Intergenic
1078338954 11:10485539-10485561 CGCAGAAGGGACAGGGAGGCCGG - Intronic
1078728065 11:13949995-13950017 CTCAGAAGGGAAAGGGAGGCTGG - Intergenic
1078775336 11:14388749-14388771 CACAGAAGGGCAAGGGAGGCAGG + Intergenic
1079146138 11:17853693-17853715 ATAAAAAGGGACCAGGAGGCTGG + Intronic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1081850359 11:46271457-46271479 TCCTAAAGGGACAAGGTGGCAGG + Intergenic
1082007125 11:47425690-47425712 CTTAAAAGGGACAAGAAGACAGG - Intronic
1082263239 11:50093861-50093883 TACAAAAAAGAAAAGGAGGCTGG + Intergenic
1082821080 11:57545131-57545153 TAAGAAAGGGACAAGGAGGCCGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1083920131 11:65778036-65778058 CACAAAAGGCTCCAGGTGGCGGG + Exonic
1084817393 11:71656870-71656892 CACACAAGGAATAAGGAGGGAGG - Intergenic
1085410780 11:76289142-76289164 GACAAAGGGGAAGAGGAGGCAGG + Intergenic
1086061710 11:82706784-82706806 CTCACAGGGGTCAAGGAGGCAGG - Intergenic
1086168250 11:83805574-83805596 GACAAAAGGGAGAGGGAGGATGG - Intronic
1086213409 11:84348651-84348673 CACAACAGGTACTAGGAGGTAGG - Intronic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1087242475 11:95794986-95795008 CAACAAAGGGACAAAGAGCCAGG - Intronic
1087797428 11:102469418-102469440 CACAAAAAGGTCAAAGAGGTTGG + Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1091834499 12:3576131-3576153 CCCAAAGGGGACAAGGAGCACGG + Intronic
1091866761 12:3845135-3845157 CACCAAAGGGAAAAGGGGGCTGG - Intronic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1092890995 12:12969111-12969133 CCCAAAAGGGAGCAAGAGGCAGG + Intergenic
1093533173 12:20191197-20191219 AAAAAAAGGGACAAAAAGGCTGG - Intergenic
1095478181 12:42607540-42607562 CCCAAAAGGGTGAAGGTGGCAGG + Intergenic
1095610523 12:44122338-44122360 CACAAAAAAGAAAAAGAGGCTGG - Intronic
1096248190 12:50008493-50008515 CTCAAAAGTGAAAAGTAGGCTGG - Intronic
1096586845 12:52628392-52628414 CACAAAAGGGAGGAGGAGAGAGG - Intergenic
1096942715 12:55365340-55365362 CACAACAGTGACAAGGAATCTGG - Exonic
1097012675 12:55964600-55964622 AAGAAAAGAGATAAGGAGGCCGG - Intronic
1097145514 12:56936903-56936925 AACAAGAGGGAGGAGGAGGCAGG - Intergenic
1097195083 12:57238681-57238703 AACAAAGGGCACAAGGAAGCAGG - Intronic
1098390917 12:69969098-69969120 CACAAAAGAGAAAAGGAGAATGG - Intergenic
1099185275 12:79509782-79509804 TGAAAAAGGGCCAAGGAGGCCGG + Intergenic
1100219178 12:92485497-92485519 CACAGAATGAACAAGAAGGCAGG + Intergenic
1100979292 12:100152247-100152269 CACAAAAAGGCTAAGGATGCTGG - Intergenic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102722941 12:115033791-115033813 CAAAAAAGGGGCACGGAGGTGGG + Intergenic
1103104616 12:118212664-118212686 CAAAAAAGGAACAGGGAGGGAGG + Intronic
1103116363 12:118336773-118336795 TACAAAAAGGGCAAAGAGGCTGG + Intronic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104457779 12:128929509-128929531 CACAAAACAGACAAGGTGCCTGG - Intronic
1104579153 12:129997054-129997076 CCCAAATTGGACAAGCAGGCTGG - Intergenic
1105955967 13:25282900-25282922 TTAAAAAGGGACAAGCAGGCCGG - Intronic
1106439681 13:29754999-29755021 GATAAAAGGAACAAAGAGGCTGG + Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1107258971 13:38467911-38467933 CAGAAAAGGGACAAACAAGCAGG - Intergenic
1108590756 13:51911090-51911112 CACCAAAGTGATAAGGTGGCAGG - Intergenic
1109198230 13:59402628-59402650 CACAAAAGGAAAAAGCAGGCTGG + Intergenic
1109322296 13:60825957-60825979 AACAAAAGGGAAAAGGGGCCAGG - Intergenic
1112470242 13:99681880-99681902 CAGAAAAGATGCAAGGAGGCAGG - Intronic
1114754118 14:25239817-25239839 CATAAAAAGGCCAAGGGGGCTGG + Intergenic
1114823386 14:26048831-26048853 CACAAAAGGGAAAAGAAGAGAGG + Intergenic
1116577157 14:46588649-46588671 AGCAAAAGGGAAAAGGAGACAGG + Intergenic
1117142806 14:52806859-52806881 CACAAAAGAAACAACCAGGCCGG + Intergenic
1117151082 14:52888977-52888999 GACAGAAGGGAGAAGGAGACGGG + Intronic
1119463168 14:74829131-74829153 CACACAGGGGAAAAGAAGGCTGG - Intronic
1120527148 14:85590348-85590370 AACAGAAGGGACAAGAAGACAGG - Intronic
1120563780 14:86029446-86029468 TACAAAAGGCACAATTAGGCTGG - Intergenic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121415224 14:93774676-93774698 TACAAAAGGGGCAGGGAGGACGG - Intronic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1122188851 14:100023756-100023778 TAAAAAAGGCAAAAGGAGGCTGG - Intronic
1124397936 15:29321351-29321373 CATAAAAGTGAAAAAGAGGCTGG + Intronic
1124411793 15:29443207-29443229 TACATGTGGGACAAGGAGGCTGG - Intronic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1127087445 15:55437663-55437685 TATAAAAGGTAGAAGGAGGCAGG + Intronic
1128055703 15:64698652-64698674 CAAGAAAGGGACAAGTAGGCAGG - Intronic
1128356954 15:66934908-66934930 GACTAAAGGGACACTGAGGCAGG + Intergenic
1129754513 15:78089081-78089103 CACAAAAAGGCTAAGGATGCTGG - Intronic
1129991754 15:79971271-79971293 CACGAAAGTGACTAGGAGGAAGG - Exonic
1130337871 15:82972995-82973017 TATAAATGAGACAAGGAGGCAGG - Intronic
1132073503 15:98800160-98800182 CCTAGAAGGGCCAAGGAGGCTGG - Intronic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133458283 16:5962448-5962470 CACATAATGGGAAAGGAGGCAGG - Intergenic
1135541193 16:23331614-23331636 TATAAAAGTGACCAGGAGGCCGG - Intronic
1135889322 16:26342981-26343003 TACAAAAGAGACAAGGAGCCTGG - Intergenic
1139215181 16:65120801-65120823 AAAAAAACGGACAAGGAAGCCGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1141000452 16:80302672-80302694 AACAGAATGGACAAGCAGGCTGG - Intergenic
1141366428 16:83447675-83447697 GACAAAAGGGTAATGGAGGCTGG + Intronic
1142572798 17:886067-886089 CACAAAAGGCACAAAGAGGCTGG + Intronic
1142703001 17:1675810-1675832 CACCTGTGGGACAAGGAGGCTGG + Exonic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1143360899 17:6370192-6370214 AATAAAATGAACAAGGAGGCCGG + Intergenic
1143366774 17:6413821-6413843 CACAGCTGGGACACGGAGGCTGG - Intronic
1143380855 17:6495586-6495608 GACAAAAGGGACCACCAGGCTGG + Intronic
1143547133 17:7604131-7604153 CAAGAAAGGGATGAGGAGGCCGG + Intronic
1143890873 17:10101490-10101512 CACAAGAGTGACCAGGAGGCAGG + Intronic
1144494277 17:15736860-15736882 CACAGAAGGGCCAGGGTGGCCGG + Intronic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144612859 17:16739400-16739422 CAAGAAAGTGAAAAGGAGGCTGG - Intronic
1144682483 17:17205111-17205133 CACAAAAGGCAACAGCAGGCTGG + Intronic
1144899926 17:18576187-18576209 CAAGAAAGTGAAAAGGAGGCTGG + Intergenic
1145132518 17:20369478-20369500 CAAGAAAGTGAAAAGGAGGCTGG - Intergenic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1146291449 17:31610501-31610523 CTCACAAGGGACAGGGAGGAAGG + Intergenic
1146464707 17:33077121-33077143 CACAGAAGGGACAAGCAGAAGGG - Intronic
1146649237 17:34596544-34596566 CAAAAAAGGGAAACTGAGGCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149726056 17:58895807-58895829 CTCAAAAAAGAAAAGGAGGCCGG + Intronic
1150142534 17:62742434-62742456 CACAAAATGGAGTAGGAGCCAGG - Intronic
1150215159 17:63463691-63463713 CTCAAATGGGACAATTAGGCTGG - Intergenic
1150464623 17:65381558-65381580 CAGAAAAGAGAAAATGAGGCAGG + Intergenic
1151054661 17:71017618-71017640 CATAAAAGGCCCAAGAAGGCAGG - Intergenic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151293219 17:73165144-73165166 CACAAGAGGGTCGAGGAGCCAGG + Exonic
1151534072 17:74727540-74727562 CACAGCAGGGACACTGAGGCAGG - Intronic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1155081856 18:22418356-22418378 CACCAAAGGGATAAGGGGGCAGG - Intergenic
1155907410 18:31468508-31468530 AACAGAGAGGACAAGGAGGCAGG + Intronic
1156042912 18:32843532-32843554 AACAGAAGTGACAAGGAAGCAGG + Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1159686217 18:71424068-71424090 CACACAAGGCAAATGGAGGCAGG - Intergenic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1161024203 19:2028026-2028048 CACAAAAGGGAAACCGAGGCAGG + Intronic
1161535317 19:4815838-4815860 CGCAAAAGGGAACAGGAAGCGGG - Intergenic
1161806032 19:6443522-6443544 TATAAAGGGGAGAAGGAGGCCGG - Intronic
1162776352 19:12982082-12982104 CACAAAAGGGGAAAGAAGGCAGG - Intergenic
1163139824 19:15339838-15339860 AAAAAAAGGGAAAAAGAGGCCGG + Intergenic
1165367644 19:35378630-35378652 CTCAACAGGGTCAAGGACGCAGG - Intergenic
1165689039 19:37848634-37848656 CAAAAATGGGAAAAGCAGGCCGG + Intergenic
1166390325 19:42405671-42405693 TTCAAAAGGGATAAGGAGGCTGG + Intronic
1166420595 19:42633223-42633245 TAGAAAAGAGACAGGGAGGCAGG - Intronic
1166432687 19:42740572-42740594 AACAGGAGGGACAAGGAGGCAGG - Intronic
1166435795 19:42765769-42765791 AACAGGAGGGACAAGGAGGCAGG - Intronic
1166695557 19:44849461-44849483 CACAGAAGGGACAGGGAGCTGGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167168201 19:47813642-47813664 CCCACAAGGGACAACGAGGAGGG - Intronic
926306577 2:11641400-11641422 AACAGAAGAGAGAAGGAGGCAGG + Exonic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
927431433 2:23029529-23029551 CACAAAAGGAACACGTAGGAGGG - Intergenic
929664994 2:43827026-43827048 CTAAAAAGTGACAAGGGGGCCGG + Intronic
929696392 2:44120041-44120063 CCCTAAACTGACAAGGAGGCTGG - Intergenic
930511677 2:52353023-52353045 CACAAAACGGACAAAGACACAGG + Intergenic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
933667336 2:84974122-84974144 CACTAAAGAAACACGGAGGCTGG - Intronic
934232168 2:90193850-90193872 TACAAAAGGGGCAAGGGGCCAGG + Intergenic
935266623 2:101400524-101400546 TACAGAAGGGACAGGGTGGCGGG - Intronic
935922228 2:108028842-108028864 CACCAAAATGGCAAGGAGGCAGG + Intergenic
936071635 2:109375265-109375287 GGCGAAAAGGACAAGGAGGCAGG - Intronic
936772728 2:115934488-115934510 CACACAAGGGACATGGAGATTGG - Intergenic
937235886 2:120431791-120431813 CAGAGACGGGACAAGGAGCCTGG - Intergenic
937271395 2:120655070-120655092 CTAAGAAGGGACCAGGAGGCAGG + Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939159771 2:138574138-138574160 TACAAAAGGAACAAGGGGGTGGG - Intergenic
941746195 2:169089212-169089234 GACTGAAGGGACAAGGAGACAGG + Intronic
942208534 2:173647755-173647777 AAAAAAAGGGACAAGTAGACAGG + Intergenic
942272696 2:174292707-174292729 CACTCAAGAGACAAGGTGGCTGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943938969 2:193965381-193965403 CACAGAAGGGACTAGGTGGGAGG + Intergenic
944458934 2:199924109-199924131 TACAAAAGGGCAAAGGAGGCTGG + Intronic
944841683 2:203629931-203629953 AACAAAATAGACAATGAGGCAGG - Intergenic
946071744 2:217040002-217040024 CTCTAAAGGGACAGGGAGGAGGG - Intergenic
948144606 2:235699097-235699119 CACAGGAGGGACGGGGAGGCAGG + Intronic
948777848 2:240299167-240299189 CAAGGAAGGGACAAGGAAGCTGG - Intergenic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
1168846195 20:946258-946280 AACAAGAGAGGCAAGGAGGCTGG - Intergenic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1170963815 20:21049034-21049056 CACAAAAGGCACTGGGAGGGTGG + Intergenic
1171077808 20:22146941-22146963 CACCCAAGGGACAAAGAAGCTGG + Intergenic
1172409057 20:34709145-34709167 CACACACCGGACAAGGGGGCGGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172644867 20:36462721-36462743 CACAAAGGGGGAAAGGAGGGAGG + Intronic
1172959039 20:38784507-38784529 GAGAAAAGAGCCAAGGAGGCCGG - Intergenic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1173191853 20:40882889-40882911 CATAAAGGGGACTTGGAGGCTGG - Intergenic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173674035 20:44818317-44818339 CACAAAATGGAGGAAGAGGCAGG + Intergenic
1173729224 20:45317040-45317062 CAGCAAAGGGGCAAGGAAGCAGG - Exonic
1174421097 20:50399647-50399669 GACAAGAGTGACAAGAAGGCAGG + Intergenic
1174432014 20:50477211-50477233 CACAACAGGGGCAGGGAGGGAGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174533777 20:51235636-51235658 TACAAAGGGGACAAGGAGGCTGG + Intergenic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1177159296 21:17530259-17530281 GAAAAAAGGGTGAAGGAGGCCGG - Intronic
1178464413 21:32833627-32833649 CAGAAAAGGACCAAAGAGGCAGG + Intergenic
1178741686 21:35207254-35207276 CACACAGGGGCCAAGGAGACAGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1181102550 22:20551105-20551127 CACAAAGGGGACAGGCAGGTTGG - Intronic
1181325275 22:22040119-22040141 GACAAGATGGACAAGGAGGTGGG + Intergenic
1181596321 22:23917287-23917309 CCCAGAGGGGACCAGGAGGCTGG - Intergenic
1181673849 22:24439355-24439377 CTCAGAAGGTGCAAGGAGGCCGG - Intronic
1181856570 22:25785398-25785420 CACAGAAGGAACCAGGAGTCAGG - Intronic
1181935275 22:26433809-26433831 CACGAAGAGGACCAGGAGGCAGG - Exonic
1182154288 22:28054583-28054605 CATAAAGGGGACAAGATGGCGGG - Intronic
1182342703 22:29636859-29636881 CTCAAAATGGACAAGAAGGTTGG + Exonic
1183079836 22:35449334-35449356 CACGATAGGGGCAAGGAGCCTGG - Intergenic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1184237718 22:43193559-43193581 AAAAAAATGGACAAAGAGGCTGG - Intergenic
1184264763 22:43341209-43341231 TGGAAAGGGGACAAGGAGGCAGG + Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1185401385 22:50619884-50619906 CACAAAGGAGCCAAGGAGGCTGG + Intergenic
950751176 3:15129322-15129344 CACACAAGGAATAAGGAGGGAGG - Intergenic
951703197 3:25516921-25516943 AATAAAAGGGACAAGGAAGCTGG - Intronic
952131918 3:30373796-30373818 TACAAAAGGGGCAAGGAAGTTGG + Intergenic
952522062 3:34171120-34171142 CACATTAGGGACAATGAAGCAGG + Intergenic
952718209 3:36503727-36503749 CACAAAATGGGCAGGAAGGCTGG - Intronic
953237475 3:41119158-41119180 CATCCAAGGGACAAGGAAGCTGG + Intergenic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
959904313 3:111693801-111693823 CACAAAGGGGTGAAGGAGGTGGG - Intronic
961283816 3:125784072-125784094 CACACAAGGAATAAGGAGGGAGG - Intergenic
962783446 3:138743855-138743877 GTCAAAAGGGACATGTAGGCCGG - Intronic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
964183497 3:153914773-153914795 CACGAAAGAGACAAGGAGAATGG + Intergenic
966776603 3:183548118-183548140 TAAAAAAGAGACAAGGAAGCAGG + Intronic
967212887 3:187184511-187184533 CACAAAAGAAGCAAAGAGGCCGG - Intergenic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
968734358 4:2287742-2287764 CACAAAAGGCACTGGGAGGGCGG - Intronic
969013889 4:4090137-4090159 CACACAAGGAATAAGGAGGGAGG + Intergenic
969053607 4:4388305-4388327 CACAAAAGGAACAAAGAGGAAGG - Intronic
969425123 4:7119848-7119870 CACAACAGGGGCAAGGGTGCAGG - Intergenic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969740096 4:9018298-9018320 CACACAAGGAATAAGGAGGGAGG - Intergenic
969799260 4:9549807-9549829 CACACAAGGAATAAGGAGGGAGG - Intergenic
971361533 4:25942622-25942644 CCCACAAGGGGCAAGGAAGCTGG - Intergenic
971963971 4:33527313-33527335 CACAGAAGGGACAGGAAGGAGGG - Intergenic
972610593 4:40652172-40652194 CACAAAAAGAAAAAAGAGGCCGG + Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
975331723 4:73123470-73123492 CACACAAGAGACAAGGAGCCTGG - Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
976203631 4:82603672-82603694 CACAAACTGGACTAGGAGTCAGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
979810171 4:125027047-125027069 CACAAAAGAAAGATGGAGGCCGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981471001 4:145134778-145134800 CACCAAAGGGAAAAGGGGGCTGG + Exonic
982277139 4:153647561-153647583 CACTCAAGGGGGAAGGAGGCTGG + Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983219167 4:165027958-165027980 CTCAAAAGTGACAAGCCGGCCGG + Intergenic
983226846 4:165093664-165093686 CACAAAACTGATAAGGAGGCTGG - Intronic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985809826 5:2074817-2074839 CACAAAATAGACAAGAAGACGGG + Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986606183 5:9525498-9525520 GACAGAAGGGACAAGGACCCAGG + Intronic
986854925 5:11857376-11857398 AACAAAAATGACAATGAGGCTGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987075715 5:14380188-14380210 GACAAGAGGGACACGGAGACAGG - Intronic
988904919 5:35776932-35776954 CTTAAAAGGTACAAAGAGGCAGG + Intronic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
989973694 5:50555783-50555805 TACAAAAGTTACAAGGAGCCGGG - Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
991304443 5:65161332-65161354 TTCAAAAGAGACAAGGAGGCCGG - Intronic
992158992 5:73982269-73982291 CACCCAAGGGACAATGAAGCAGG - Intergenic
992490457 5:77238533-77238555 CACAAAAATGACAAAGATGCTGG - Intronic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
995438161 5:112160685-112160707 CACCAAAGGGAGGAGGAGCCTGG - Intronic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
997308804 5:132862282-132862304 CACTAAAGGTTGAAGGAGGCTGG + Exonic
997336549 5:133112815-133112837 CATAAAAGAGACAAGAAGGCCGG + Intergenic
997611200 5:135216953-135216975 CACAAAAGGGACAAATTAGCTGG - Intronic
999352776 5:150892320-150892342 TACAGAAGGGAAAGGGAGGCAGG + Intronic
999978782 5:156938901-156938923 CACACAAGGGCCGAGGAAGCTGG - Intronic
1002599415 5:180345853-180345875 GACAAGAGGGACACAGAGGCAGG + Intronic
1002900934 6:1409113-1409135 CACAAAAGGGCCAAGTACTCAGG + Intergenic
1003353267 6:5340849-5340871 CACAAAATGGATGAGGAGGCCGG + Intronic
1003382875 6:5640822-5640844 AAGAAAAGGGACAAGGAGTGGGG - Intronic
1004380978 6:15132175-15132197 AGAAAAAGGCACAAGGAGGCGGG - Intergenic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1005944971 6:30588902-30588924 GACAAGAGGGACAAGCAGGAGGG - Intronic
1006670668 6:35728053-35728075 CACAAACAGGGCGAGGAGGCTGG + Intronic
1008453291 6:51678406-51678428 CATAAAAGGCAAAAGGAGACTGG - Intronic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1011872539 6:91914077-91914099 AACGAAAGGGACAAGGAGTTTGG - Intergenic
1013052605 6:106551128-106551150 TACAAAAGGGGCCAGGAGGGAGG - Intronic
1014026708 6:116656378-116656400 AACAAAAGTGAAAAGGAGGCTGG - Intronic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1016835004 6:148468091-148468113 AACAAAGGGGGCAGGGAGGCGGG - Intronic
1018204480 6:161424428-161424450 CACAGAAGGGGCAAAGAGGAAGG + Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018421543 6:163644488-163644510 GACAGAAGGGACAAAGAGCCTGG + Intergenic
1018772909 6:166987640-166987662 GTCAAAAGGGAAAAGAAGGCTGG + Intergenic
1018938378 6:168289767-168289789 CACCAAAGTGATAAGGGGGCAGG - Intergenic
1019007189 6:168808830-168808852 CACAAATGGGCTAAGGAGGGAGG + Intergenic
1019076804 6:169394422-169394444 CCCAAAAGGGAGAGAGAGGCGGG + Intergenic
1022973418 7:35537034-35537056 CAAACAAGGCCCAAGGAGGCTGG + Intergenic
1023275455 7:38514660-38514682 CACAAAACGGAAAAGAAGTCAGG - Intronic
1023722606 7:43112376-43112398 CACAAAAGGGCCGAGGAGCCAGG + Intergenic
1023888545 7:44377045-44377067 CACAGGAGGGACAGGGAGGGAGG - Intergenic
1028376865 7:90154407-90154429 CGCGCAACGGACAAGGAGGCGGG + Exonic
1028869768 7:95756799-95756821 CAGAAAAGGGACAGGTAGTCAGG - Intergenic
1029072541 7:97911755-97911777 CACACAAGGAATAAGGAGGGAGG + Intergenic
1029345049 7:99972354-99972376 AACAAAAGGGACAAGCCAGCTGG - Intronic
1029599656 7:101556234-101556256 CACCATAGGGACAAAGAGGAGGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1031863690 7:127013427-127013449 CACAAAGGGGAAAGGAAGGCAGG + Intronic
1031941525 7:127794439-127794461 CACAGAAGGGAAAATAAGGCTGG - Intronic
1032689959 7:134275873-134275895 CACAAAAAGGACAAGGATATTGG + Intergenic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1034380312 7:150686598-150686620 CTCATAAGGGACAAGGTGGGTGG - Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035905730 8:3508177-3508199 AACCAAAGAGACAAGGAGGTTGG - Intronic
1036245125 8:7109547-7109569 CACACAAGGAATAAGGAGGGAGG - Intergenic
1036255624 8:7204262-7204284 CACACAAGGAATAAGGAGGGAGG + Intergenic
1036361861 8:8083240-8083262 CACACAAGGAATAAGGAGGGAGG - Intergenic
1036511328 8:9403089-9403111 CACAAAAAAGAAAAGCAGGCAGG + Intergenic
1036603771 8:10288083-10288105 TACAAAAGTGAAAATGAGGCTGG + Intronic
1036889106 8:12583775-12583797 CACACAAGGAATAAGGAGGGAGG + Intergenic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037572694 8:20172160-20172182 CCCAGAAGTGACAAGGAGCCAGG + Intronic
1037682037 8:21105611-21105633 CCCAAAAAGCACAAGGAGCCAGG + Intergenic
1038060440 8:23906355-23906377 CACTAAAGGGACTAACAGGCAGG - Intergenic
1040300129 8:46183651-46183673 CACCAGAGGGACATAGAGGCAGG - Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040608710 8:48961283-48961305 CACAAAAGTGACAAGGAGTTTGG + Intergenic
1040801509 8:51346743-51346765 GGCAAAAGGGAGCAGGAGGCAGG - Intronic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1041908104 8:63055584-63055606 CACAGAGGGGACAAAGGGGCAGG + Intronic
1042039659 8:64578268-64578290 CACAAAAAGGGCAAGCTGGCTGG + Intergenic
1042555893 8:70033468-70033490 CAAGAAAGTGACAAGGAGGTGGG + Intergenic
1042602587 8:70512899-70512921 CACAAAAGCGGCCAGGAGGGAGG + Intergenic
1043519263 8:81026664-81026686 CAGGAAAGGAACAAGCAGGCAGG + Intronic
1043670830 8:82882101-82882123 CACAACAGGGACAAGGAATGGGG - Intergenic
1044857623 8:96493134-96493156 CAAAAAAGGGACATGGAGGAAGG - Intergenic
1045514733 8:102848615-102848637 CTGAAAAGGGACAAGTAGGTGGG + Intronic
1048348918 8:133600041-133600063 CACAAAGGGGACAATGAGTAAGG - Intergenic
1049435525 8:142584517-142584539 CACAAAGGGGACACCGAGCCTGG + Intergenic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1050616199 9:7404136-7404158 CTCCCAAGGGACAAGGAAGCTGG - Intergenic
1052351437 9:27462860-27462882 CACAAAATGGGCAAGAAGACTGG + Intronic
1052745930 9:32441019-32441041 CACAGAAGAGAAAAGGAGCCTGG + Intronic
1053618621 9:39794293-39794315 TAGATAAGGGACAAGGAGGGAGG - Intergenic
1053792749 9:41698747-41698769 CACTAATGGGACAAGAAGGGAGG + Intergenic
1053876796 9:42553655-42553677 TAGATAAGGGACAAGGAGGGAGG - Intergenic
1053895878 9:42741050-42741072 TAGATAAGGGACAAGGAGGGAGG + Intergenic
1054181162 9:61910768-61910790 CACTAATGGGACAAGAAGGGAGG + Intergenic
1054234901 9:62548067-62548089 TAGATAAGGGACAAGGAGGGAGG + Intergenic
1054265534 9:62913136-62913158 TAGATAAGGGACAAGGAGGGAGG + Intergenic
1054656429 9:67670374-67670396 CACTAATGGGACAAGAAGGGAGG - Intergenic
1055694904 9:78873360-78873382 GAATAAAGGAACAAGGAGGCCGG - Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056820730 9:89840168-89840190 AGGAAAAGGGACTAGGAGGCAGG + Intergenic
1057279688 9:93700751-93700773 TACAAATGGGAAAGGGAGGCTGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058217085 9:102248178-102248200 CACAAAATGGAGAATGAGGAAGG - Intergenic
1058876955 9:109252675-109252697 TACAGAAGGGGCCAGGAGGCTGG + Intronic
1059029757 9:110678437-110678459 CATAAAAGCTACAAGGAGCCAGG - Intronic
1059726988 9:117018493-117018515 CACAAGAGACACAAGCAGGCAGG - Intronic
1061591475 9:131600487-131600509 CACAAGAGTGGCCAGGAGGCAGG + Intronic
1062483857 9:136764626-136764648 CAAACAATGGACAAGGGGGCCGG - Intronic
1203491318 Un_GL000224v1:108188-108210 CCCAAAAGGGGCAGGGAGGGGGG - Intergenic
1203503942 Un_KI270741v1:50058-50080 CCCAAAAGGGGCAGGGAGGGGGG - Intergenic
1185891755 X:3828271-3828293 CACAGCAGGGACAAGGGGCCGGG - Intronic
1185896863 X:3866687-3866709 CACAGCAGGGACAAGGGGCCGGG - Intergenic
1185901981 X:3905113-3905135 CACAGCAGGGACAAGGGGCCGGG - Intergenic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1187425538 X:19174606-19174628 CACCCAAGGGGCAAGGGGGCTGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188523609 X:31065465-31065487 AATAAAAGGGACAAGGACTCTGG + Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1189229923 X:39444198-39444220 AGCAAATGAGACAAGGAGGCTGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190216486 X:48482433-48482455 CACAAAAGGCACAATGATGCGGG - Exonic
1191938638 X:66453792-66453814 CACAAAAGAGACAAGTAGCTTGG - Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192432389 X:71121229-71121251 CACAACTGGGGCAAGGTGGCAGG - Intronic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1192673141 X:73167584-73167606 AACAAAGTGGACAAGGTGGCAGG - Intergenic
1192833801 X:74778295-74778317 CACAGAAGGGGCAAGGAGCTGGG - Intronic
1194268729 X:91783343-91783365 GACAAAAAGGCCAAGGAGCCAGG - Intronic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195405917 X:104513151-104513173 CTCAAAAGGGACAGGGAGAGTGG - Intergenic
1195611074 X:106867238-106867260 GAAAAATGGGACAAGGAAGCAGG + Intronic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1197257861 X:124283384-124283406 AAAAAAAGGGCAAAGGAGGCCGG - Intronic
1197415158 X:126165500-126165522 CTCATGCGGGACAAGGAGGCCGG - Exonic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1197934895 X:131729843-131729865 CAAAAAAGAGAAAAGGAGCCGGG + Intergenic
1198550944 X:137744172-137744194 GTCAAAAGTGACAAAGAGGCCGG - Intergenic
1199526745 X:148801301-148801323 AATAGAAGGGATAAGGAGGCGGG - Intronic
1200585931 Y:5004259-5004281 GACAAAAAGGCCAAGGAGCCAGG - Intronic