ID: 1174485755

View in Genome Browser
Species Human (GRCh38)
Location 20:50860178-50860200
Sequence GTTTTGAAGCATGTTACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174485755_1174485757 0 Left 1174485755 20:50860178-50860200 CCAGTGGTAACATGCTTCAAAAC No data
Right 1174485757 20:50860201-50860223 CATAGCACAATATCCCAACCAGG 0: 1
1: 1
2: 17
3: 83
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174485755 Original CRISPR GTTTTGAAGCATGTTACCAC TGG (reversed) Intronic
No off target data available for this crispr