ID: 1174486320

View in Genome Browser
Species Human (GRCh38)
Location 20:50863668-50863690
Sequence GACTCTGATGTGACAGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174486319_1174486320 24 Left 1174486319 20:50863621-50863643 CCTTCAAGGATTCTATTGATAAT 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG 0: 1
1: 0
2: 2
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174486320 Original CRISPR GACTCTGATGTGACAGCAGT TGG Intronic
900667976 1:3828394-3828416 GACTCTGACGTTCCAGCATTTGG + Intronic
900739067 1:4319481-4319503 GTCTCTGATTTCACAGCTGTAGG + Intergenic
903832803 1:26184566-26184588 GACTCTGAAAGGACAGCAGAAGG - Exonic
904855599 1:33495910-33495932 GACTCTGGTGAGAGAGGAGTTGG + Exonic
906907535 1:49911987-49912009 GGATCTGCTGTGACAGAAGTTGG - Intronic
908949934 1:69548167-69548189 GCCTCTGATCTGACAGGAGGAGG - Intergenic
911700045 1:100941984-100942006 GACTGCGACGTGACGGCAGTGGG + Intronic
911741541 1:101391516-101391538 TACTCTGATGTGGGAGAAGTAGG - Intergenic
917303607 1:173604785-173604807 GAGCCTGAGGGGACAGCAGTAGG - Intergenic
918515585 1:185359132-185359154 GCCTCTGATGGGGCAGCAGGGGG - Intergenic
920501766 1:206490151-206490173 GACTCTGCTATGAGAGGAGTGGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG + Intergenic
924954791 1:248915915-248915937 GAGTCTGAGGGGACAGGAGTGGG + Intronic
1064781254 10:18841289-18841311 GCCACTGATGTGACAGGAGGTGG + Intergenic
1065966446 10:30774790-30774812 GACTCTGCTGGGACATCAGATGG + Intergenic
1066640452 10:37549939-37549961 GACGCTGATTTGACAGGAGGTGG + Intergenic
1068090623 10:52428655-52428677 GCCGCTGATCTGACAGGAGTCGG + Intergenic
1068185575 10:53581268-53581290 GACTGTGATGTTACTGGAGTGGG + Intergenic
1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG + Intronic
1069906417 10:71735115-71735137 GAAGCAGATGTGACTGCAGTGGG + Intronic
1070976511 10:80609772-80609794 GGCTGTGAGGTGACAGCAGTGGG - Intronic
1072254630 10:93609540-93609562 GAAACTGATGTGGCAGCAGAGGG + Intergenic
1073818748 10:107236191-107236213 GAGTTTGTTGTGACAGCACTGGG - Intergenic
1075013262 10:118892621-118892643 GACTCTGCTGTGACAGCAAAGGG + Intergenic
1076617441 10:131765272-131765294 GCCTGTGATGGGACAGCAGCTGG + Intergenic
1078731819 11:13981842-13981864 GACTCTGATGTCCCAGGAGCAGG - Intronic
1078849514 11:15151182-15151204 GCCTCTGATCTGACAGGAGACGG - Intronic
1081563905 11:44244352-44244374 CACTCTGATGTCAGAGTAGTAGG + Exonic
1087574925 11:99977654-99977676 AACTCTCATGAGACAGCACTAGG + Intronic
1089718123 11:120383639-120383661 GCCACTGATCTGACAGAAGTGGG + Intronic
1090007029 11:123011782-123011804 GACTCTGACCTGGCTGCAGTAGG - Intergenic
1090077707 11:123589984-123590006 GACAGGGATGAGACAGCAGTGGG - Intronic
1091115574 11:133009762-133009784 GCCTCTGATCTGACAGGAGATGG + Intronic
1091865863 12:3836141-3836163 GACTTTGATGTGTCTGCATTTGG - Intronic
1091947073 12:4556373-4556395 GATTCTGATTTGACGGCAGCTGG - Exonic
1095390035 12:41695033-41695055 GCCTCTGATCTGACAGAAGGTGG - Intergenic
1095633183 12:44401642-44401664 GACTATGTTGTGACTGCAGTAGG - Intergenic
1096461589 12:51824401-51824423 GACTGTGACCTGACATCAGTGGG + Intergenic
1096751541 12:53761914-53761936 GAATCTGAAGTGACACCAGGTGG - Intergenic
1102533663 12:113565405-113565427 GACTTTGATGGGCCAGCGGTTGG - Intergenic
1102735304 12:115153840-115153862 GATTGTGCTGTGACAGCCGTAGG - Intergenic
1102768859 12:115455738-115455760 GACTGGGCTGTGACAGCAGGAGG - Intergenic
1104058277 12:125246843-125246865 GTCTCTGATGTGACACCATTTGG + Intronic
1106021181 13:25917008-25917030 GACTTTGAAGTGAGAGCAATTGG - Intronic
1106474293 13:30084149-30084171 GCCTCTGATCTGACAGGAGGTGG - Intergenic
1108534102 13:51355479-51355501 GAAGCTGATGGGACAGCAGGAGG - Intronic
1109231309 13:59761000-59761022 TATTGTGATGTGACAGCATTTGG - Intronic
1110294421 13:73846096-73846118 GATACTGATGTGATAACAGTTGG + Exonic
1110959490 13:81603427-81603449 TACTCTGATGTGACTGCATGTGG - Intergenic
1111654267 13:91132481-91132503 TGCTCTGATGTGACAGGAGGTGG + Intergenic
1111798810 13:92957777-92957799 CACTTTAATGTGACAGCTGTGGG - Intergenic
1112964866 13:105177053-105177075 GACTCTGAGGTCAGAGAAGTGGG - Intergenic
1113313685 13:109156980-109157002 GACTTTGAAGTGACAGCCGCAGG - Intronic
1117851498 14:59975993-59976015 GCCACTGATGTGACAGGAGGCGG - Intronic
1119375725 14:74190969-74190991 GCCTCTGATATGAGAGCAGCTGG - Intronic
1119792400 14:77364067-77364089 TACTCTGATGTGCCAGGTGTGGG - Intronic
1121824309 14:96998251-96998273 GTCTCTGATCTGCCAGCAGAAGG + Intergenic
1124155388 15:27220563-27220585 CTGTGTGATGTGACAGCAGTGGG + Intronic
1125250160 15:37692239-37692261 GTCTCTGATGGGAAAGCAGGAGG + Intergenic
1126158715 15:45588615-45588637 GACAGTGATGTGACAGCAGCGGG - Intronic
1126349408 15:47729099-47729121 GACTTTGAAGTGACAGCCTTGGG - Intronic
1126559461 15:50027220-50027242 GACTCTTATTTGACAGCAGTAGG - Intronic
1129969517 15:79765736-79765758 GACTCAGATATGACAGAAGTTGG - Intergenic
1130642899 15:85695875-85695897 GACTCTTCTGGGACACCAGTCGG + Intronic
1133344962 16:5063591-5063613 GCCACTGATCTGACAGCAGGCGG - Intronic
1137990972 16:53154699-53154721 GCCGCTGATGTGACAGGAGGCGG + Intronic
1143063170 17:4220891-4220913 GACTCAGAAGAGAAAGCAGTTGG + Intronic
1144761158 17:17708222-17708244 GACCCTGAGGTGGCAGCAGGAGG + Intronic
1147861563 17:43527091-43527113 GACTGAGATGTGACAACAGGTGG - Intronic
1148344575 17:46894838-46894860 CACTCTGATGTGTGAGCATTGGG + Intergenic
1151070282 17:71202241-71202263 GACTGTGAAGTCACAACAGTGGG + Intergenic
1151923829 17:77178750-77178772 GCCACTGATGTGACAGGAGGTGG + Intronic
1153744911 18:8167777-8167799 GGCTCTGATATGGGAGCAGTTGG + Intronic
1155272676 18:24155973-24155995 AACTCTGGTGAGACAGCTGTTGG - Exonic
1158880980 18:61779569-61779591 GAGTCTGTTGTGACAGGAGAGGG - Intergenic
1159735355 18:72090501-72090523 GACTCTGATACGATAGCAGATGG + Intergenic
1159817191 18:73089885-73089907 GACTCTGATTTGGCAACATTTGG + Intergenic
1165476962 19:36036203-36036225 GATTCTCAGGTGATAGCAGTTGG - Intronic
1167868792 19:52350330-52350352 GACACAGAGCTGACAGCAGTGGG - Intronic
925402451 2:3585420-3585442 GTCTCTGATGAGACAGTGGTGGG + Intergenic
926762568 2:16291908-16291930 GACTCAGATGGGACAACACTTGG - Intergenic
929532673 2:42762580-42762602 GACTCTGCTGTGACAGTGATTGG + Exonic
929563711 2:42971439-42971461 GACTCTCAGATGACAGCTGTGGG + Intergenic
931388651 2:61820189-61820211 GACTTAGACATGACAGCAGTGGG - Intergenic
932485246 2:72080733-72080755 GACTGGGCTGTGACAGCACTGGG - Intergenic
936025940 2:109031306-109031328 GGCTCTGATGTGGCAGGGGTGGG + Intergenic
936576826 2:113664176-113664198 GACTCTGATGCCAGAACAGTGGG - Intergenic
939370407 2:141292081-141292103 GCCTCTGATCTGACAGGAGGTGG - Intronic
942158457 2:173156654-173156676 GCCTCTGATCTGACAGGAGGCGG + Intronic
942466140 2:176209124-176209146 GTCACTCAAGTGACAGCAGTCGG - Intergenic
943248139 2:185482888-185482910 GCCTCTGATCTGACAGGAGGTGG - Intergenic
943993557 2:194730396-194730418 GATTCTTAAGTGACAACAGTTGG + Intergenic
944302770 2:198143309-198143331 GCTGCTGATGTGACAGGAGTGGG + Intronic
945027431 2:205632434-205632456 GACACTGATCTGACAGGAGGCGG - Intergenic
946403119 2:219479193-219479215 GAGTCTGAGGTGAGGGCAGTGGG + Exonic
948334449 2:237196363-237196385 GACTCTGGTGTAACAGGAGCAGG + Intergenic
948450320 2:238066248-238066270 CACTATGATGTGACTGCAGTGGG - Intronic
948630192 2:239297438-239297460 GACACTGGTGTGACAGCATAGGG + Intronic
1171226478 20:23445825-23445847 GGCTGTGATATGACAGCAATGGG + Intergenic
1171231520 20:23490919-23490941 GACTCTGAGGGCACAGCAGGAGG + Intergenic
1171460572 20:25295790-25295812 GATTCTGATCTGTCATCAGTCGG + Intronic
1173170466 20:40719376-40719398 GACACTCATGTGACAACTGTGGG - Intergenic
1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG + Intronic
1175052276 20:56166602-56166624 GCCGCTGATCTGACAGGAGTCGG - Intergenic
1177420700 21:20853095-20853117 GAATGTGATGTGACAGTAGAAGG - Intergenic
1178475056 21:32930836-32930858 GCCTCTGATCTGACAGGAGGTGG + Intergenic
1179097496 21:38328718-38328740 GCCACTGATTTGACAGCAGGTGG + Intergenic
1180038722 21:45264835-45264857 TGCTCTGACGTGCCAGCAGTAGG + Exonic
1180880604 22:19201130-19201152 GAATCTGATGTGGAACCAGTTGG - Intronic
1181364127 22:22361552-22361574 GACTATGATTTGATAGCTGTTGG + Intergenic
1181386862 22:22552752-22552774 GACCCTGAGGTGACAGTAGAAGG + Intronic
1182745177 22:32600319-32600341 GCCTCTGATCTGACAGGAGATGG + Intronic
1183226434 22:36553435-36553457 GCCGCTGATGTGACAGGAGGTGG + Intergenic
1183353145 22:37344595-37344617 GCCTCTGATGTGGCAGGAGGAGG + Intergenic
1183933962 22:41251236-41251258 GACTCTGAAGGGACAGCATGGGG - Intronic
1183936228 22:41264004-41264026 GACACAGAAGTAACAGCAGTTGG - Intronic
1184099682 22:42335607-42335629 GACTCTGAGCAGACAGCAGGGGG + Intronic
1184315846 22:43688567-43688589 GAGTCTGAGGTCACATCAGTAGG - Intronic
1184912367 22:47544797-47544819 GTCTCTGATTGGACAGCAGCAGG + Intergenic
1185423587 22:50749153-50749175 GACTCTGATGCCAGAACAGTGGG + Intergenic
950969229 3:17169987-17170009 GCCTCTGATCTGACAGGAGGTGG + Intronic
951553603 3:23898874-23898896 GCCACTGATGTGACAGGAGGCGG - Intronic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
954849348 3:53587256-53587278 GACTCTGGGGTGACTGAAGTGGG + Intronic
956013561 3:64857620-64857642 GACTCTGAGCTTCCAGCAGTTGG - Intergenic
956247990 3:67205344-67205366 GCCTCTGATCTGACAGGAGGAGG - Intergenic
957707726 3:83812208-83812230 GCCTCTGATCTGACAGGAGATGG - Intergenic
958118921 3:89259300-89259322 GACTGTGATGTGATAGGAGGTGG - Intronic
960878192 3:122317597-122317619 GACTTAGACATGACAGCAGTGGG - Intergenic
960973870 3:123157325-123157347 GACTCTGATCTGATAGTTGTAGG - Intronic
961195023 3:124994239-124994261 GCCGCTGATGTGACAGGAGGCGG + Intronic
961443619 3:126967521-126967543 GCCTCTGATCTGACAGGAGGCGG + Intergenic
966237298 3:177716286-177716308 AACTCTAGTGTGACATCAGTTGG - Intergenic
972739871 4:41879132-41879154 GACTCTGTTTTGACAGTAGCTGG + Intergenic
974611104 4:64217369-64217391 GAAACAGATGTGACAGCAGATGG - Intergenic
975757394 4:77584262-77584284 AACTGTGATGTGAGAGGAGTTGG - Intronic
979294909 4:119021088-119021110 GATATTGATGTGTCAGCAGTGGG + Intronic
980606962 4:135104996-135105018 GACTCTGAGGTGAAGGCAGAGGG + Intergenic
981928915 4:150169141-150169163 GACTCTCATCTGACACAAGTAGG + Intronic
981998637 4:151001861-151001883 GCCTCAGTGGTGACAGCAGTGGG - Intronic
982932714 4:161428991-161429013 GACTCTTACTTCACAGCAGTGGG - Intronic
985673207 5:1216983-1217005 GACTCTGAGGTGCCAGCAAGGGG - Intronic
987447429 5:18037623-18037645 AACTCTGATCTGACAGAAGGTGG - Intergenic
990048874 5:51469993-51470015 GGCTCTGATCTGCCAACAGTGGG - Intergenic
992512432 5:77451302-77451324 AACTGTGTTGTGGCAGCAGTTGG - Exonic
992582506 5:78195450-78195472 GGCTCTTTTGTGAAAGCAGTTGG - Intronic
995009751 5:107243816-107243838 GTGGCTGATGTGGCAGCAGTTGG - Intergenic
995501344 5:112810268-112810290 AACTCTGATGTCACAGCAAAAGG + Intronic
996318806 5:122191088-122191110 GACTGAGATGAGACAGCAGGTGG + Intergenic
997172421 5:131736585-131736607 GAGGCTGATGTGACAGGAGGTGG - Intronic
997405068 5:133639312-133639334 GACTCATATGTGGCAGTAGTCGG + Intergenic
998517343 5:142768518-142768540 GTCTCTCATGTGATTGCAGTTGG - Intergenic
999508019 5:152218539-152218561 GAATCTGATGTGACAACACATGG - Intergenic
1000993874 5:167939338-167939360 GCCACTGATGTGACAGGAGGCGG + Intronic
1001261769 5:170235699-170235721 GACTCTTAGGTGAAAGCAATAGG - Intronic
1002142276 5:177149751-177149773 ACCCCTGATGTGACAGGAGTGGG + Intronic
1002847758 6:963168-963190 CACTCTGTTTTGAAAGCAGTTGG - Intergenic
1006439436 6:34043882-34043904 CACGCTGCTGTGACAGCACTGGG - Intronic
1007244427 6:40450328-40450350 GACTCTGATGGGCCAGGAGCTGG - Intronic
1008238741 6:49083042-49083064 GACTCTTCTGTAATAGCAGTTGG + Intergenic
1009895711 6:69746430-69746452 TACTGTGGTGTGACAGCTGTGGG + Intronic
1011570634 6:88730596-88730618 GCCACTGATCTGACAGCAGGCGG + Intronic
1011791827 6:90907116-90907138 GACTCAGCTTTCACAGCAGTGGG + Intergenic
1012930194 6:105308778-105308800 GACTCTGGGGACACAGCAGTGGG + Intronic
1013226841 6:108125303-108125325 GCCTCTGCTGTGCCCGCAGTTGG + Intronic
1015088851 6:129329930-129329952 GTCTCTGATCTGACAGGAGGTGG - Intronic
1017256208 6:152336586-152336608 GCCTCTGATCTGACAGGAGGTGG + Intronic
1019133598 6:169894685-169894707 GCCTCTGATCTAACAGGAGTAGG - Intergenic
1021090127 7:16473320-16473342 GCCTCTGATGTGACACGAGGAGG - Intronic
1022827974 7:34036175-34036197 GCGTTTGATGTGTCAGCAGTAGG + Intronic
1023890963 7:44391839-44391861 GACTCTGTGATGTCAGCAGTGGG - Intronic
1025108118 7:56190132-56190154 GCCACTGATGTGACAGGAGGTGG + Intergenic
1030447102 7:109660102-109660124 TAATCTGATTTGACAGCACTGGG - Intergenic
1030538653 7:110801773-110801795 AATTCTGTTGTGCCAGCAGTGGG - Intronic
1031497236 7:122465494-122465516 GACACTGATCTGACAGGAGGTGG - Intronic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1036177263 8:6550570-6550592 GCTTCTGGTGTGACAGCTGTGGG + Intronic
1037893879 8:22639041-22639063 GACTCTGGTGTAACTGCAGGTGG + Intronic
1038372663 8:27009631-27009653 GCCGCTGATCTGACAGCAGGCGG - Intergenic
1042348435 8:67751198-67751220 CACTCTGATGTGAAAGCAACTGG + Intergenic
1049260228 8:141635039-141635061 GGCTGGGATGTGGCAGCAGTAGG + Intergenic
1050037520 9:1452945-1452967 GACTCTGAAGGGGCAGCAGGAGG + Intergenic
1051288672 9:15523296-15523318 GACTCTAAAGTGATAGCACTAGG - Intergenic
1053067547 9:35079199-35079221 GACTCTGAGGCGACAGCAGTTGG - Exonic
1053845579 9:42233034-42233056 TACTTTGATGTGACAGCCCTAGG - Intergenic
1057230868 9:93320623-93320645 GACTGGGATGTGACAGGGGTGGG + Intronic
1057932481 9:99207050-99207072 GCCTCTGATCTGACAGGAGGTGG - Intergenic
1059295301 9:113265062-113265084 GATTATGATGTGACAAAAGTTGG - Intronic
1059682446 9:116599180-116599202 CACCCTCACGTGACAGCAGTAGG - Intronic
1061215609 9:129220076-129220098 GATTCAGATGTGTCCGCAGTGGG + Intergenic
1187178902 X:16924108-16924130 GACTCTGCAGTGAGAGCAGTAGG - Intergenic
1193151633 X:78130837-78130859 CACTCTTATGTCAGAGCAGTTGG - Exonic
1193188773 X:78545014-78545036 CACTCTGGTGGGGCAGCAGTTGG + Intergenic
1195004327 X:100671323-100671345 TACCCTGAGGTGACAGCAGAGGG + Intergenic
1198710191 X:139493103-139493125 GAATATGATGTGATAGCAGGAGG - Intergenic
1198725824 X:139676075-139676097 GACACTGCTGTGTTAGCAGTAGG + Intronic