ID: 1174487984

View in Genome Browser
Species Human (GRCh38)
Location 20:50873166-50873188
Sequence CTCTCGCCACTCCCTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174487978_1174487984 13 Left 1174487978 20:50873130-50873152 CCTAAAGACGCCATCACATCTAG No data
Right 1174487984 20:50873166-50873188 CTCTCGCCACTCCCTCTCCTTGG No data
1174487980_1174487984 3 Left 1174487980 20:50873140-50873162 CCATCACATCTAGAGCTGCCGGC No data
Right 1174487984 20:50873166-50873188 CTCTCGCCACTCCCTCTCCTTGG No data
1174487977_1174487984 18 Left 1174487977 20:50873125-50873147 CCAGGCCTAAAGACGCCATCACA No data
Right 1174487984 20:50873166-50873188 CTCTCGCCACTCCCTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174487984 Original CRISPR CTCTCGCCACTCCCTCTCCT TGG Intronic