ID: 1174492584

View in Genome Browser
Species Human (GRCh38)
Location 20:50911666-50911688
Sequence CAGAGCTACCACATCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 522}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174492581_1174492584 12 Left 1174492581 20:50911631-50911653 CCAAGAATTAGTGGAGCTTGTCT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1174492584 20:50911666-50911688 CAGAGCTACCACATCAAGGATGG 0: 1
1: 0
2: 1
3: 36
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174492584 Original CRISPR CAGAGCTACCACATCAAGGA TGG Intronic
901384514 1:8898706-8898728 CAAAGCTTCCACAGCATGGAAGG - Intergenic
902209538 1:14894799-14894821 CTGTGCTATCACACCAAGGACGG + Intronic
903456170 1:23488442-23488464 CAGAGTAAGTACATCAAGGAAGG - Intergenic
903963204 1:27070297-27070319 CAGGGCTACCTCCTCAGGGAGGG - Intergenic
905325564 1:37149376-37149398 CAGAGCAGCCACATTGAGGAAGG + Intergenic
906767229 1:48444682-48444704 CAAAGCTTCCACAGCATGGAAGG - Intronic
908042423 1:60128908-60128930 CAGAGTTTCCACACCCAGGAAGG + Intergenic
908056772 1:60296031-60296053 CATTGCTATCACATGAAGGATGG + Intergenic
909244035 1:73254403-73254425 CAAAGCTTCCACAGCACGGAAGG - Intergenic
909604747 1:77497017-77497039 CAAAGCTTCCACAGCATGGAAGG - Intronic
909742027 1:79041280-79041302 CAGAGTTACTATATAAAGGAAGG + Intergenic
910043572 1:82884622-82884644 CAAAGCTTCCACAGCATGGAAGG + Intergenic
910397847 1:86809542-86809564 CAAAGCTTCCACAGCATGGAAGG + Intergenic
910595362 1:88974986-88975008 CAAAGCTTCCACACCACGGAAGG - Intronic
911297942 1:96140400-96140422 CAAAGCTTCCACAGCATGGAAGG - Intergenic
911299352 1:96153407-96153429 CAAAGCTTCCACAGCATGGAAGG - Intergenic
911345416 1:96691134-96691156 CAAAGCTTCCACAGCATGGAAGG - Intergenic
911368444 1:96968735-96968757 CAGAGCTAAGACAGCAGGGATGG - Intergenic
912020976 1:105109338-105109360 CAAAGCTTCCACAGCATGGAAGG - Intergenic
912463409 1:109852696-109852718 CAGAGCTCCCACACAATGGAAGG + Intergenic
912755024 1:112317093-112317115 CAGAGCTTCCACCCTAAGGAGGG - Intergenic
913279576 1:117172969-117172991 CAAAGCTTCCACAGCATGGAAGG - Intronic
913383366 1:118233259-118233281 CAAAGCTTCCACAGCATGGAAGG - Intergenic
913492358 1:119392771-119392793 GACAGCTACCACATCAGGAAAGG - Intronic
914919193 1:151836287-151836309 CAGAGCTACCATCTTAGGGAAGG + Intergenic
915660029 1:157396920-157396942 AAGAGCTACCTCTTCAAGGTAGG - Intergenic
915928410 1:160041856-160041878 CAGACCCACCAAACCAAGGAAGG - Exonic
915930028 1:160054661-160054683 CAGAGCTGACACAGGAAGGAGGG - Intronic
916083293 1:161250444-161250466 CAAAGCTTCCACAGCATGGAAGG - Intergenic
916084325 1:161257639-161257661 CAAAGCTTCCACAGCATGGAAGG - Intergenic
916554654 1:165883745-165883767 CAAAGCTTCCACAGCATGGAAGG - Intronic
917025758 1:170639571-170639593 CAAAGCTTCCACAGCATGGAAGG - Intergenic
917085823 1:171305244-171305266 CAAAGCTTCCACAGCATGGAAGG - Intergenic
917094963 1:171390840-171390862 CAAAGCTACCACAGCATGGAAGG + Intergenic
917203682 1:172545555-172545577 CAGAGGTACCACATGCAGCAGGG + Intronic
917675931 1:177319682-177319704 CAAAGCTTCCACAGCATGGAAGG - Intergenic
917676756 1:177325855-177325877 CAAAGCTTCCACAGCATGGAGGG - Intergenic
918024138 1:180726327-180726349 CAAAGCTTCCACAGCATGGAAGG - Intronic
918654430 1:187006665-187006687 CATAGCTTCCACAGCACGGAAGG + Intergenic
918965579 1:191343570-191343592 CAAAGCTTCCACAGCATGGAAGG + Intergenic
919009034 1:191935951-191935973 CAAAGCTTCCACAGCATGGAAGG + Intergenic
919252471 1:195074724-195074746 CAAAGCTTCCACAGCATGGAAGG - Intergenic
920639861 1:207741626-207741648 CAGAGCTCCCACACAAAGGGAGG + Intergenic
923133151 1:231094946-231094968 CAAAACTAACACATCAATGATGG + Intergenic
923172468 1:231430300-231430322 CAAAGCTTCCACAGCATGGAAGG + Intergenic
924378255 1:243436221-243436243 CAAAGCTTCCACAGCATGGAAGG + Intronic
924730930 1:246710931-246710953 CAAAGCTTCCACACCATGGAAGG - Intergenic
1063585501 10:7348999-7349021 CAGAGATCCCAGGTCAAGGATGG + Intronic
1064665651 10:17648453-17648475 CAAAGCTTCCACAGCATGGAAGG - Intronic
1065295110 10:24266835-24266857 CAAAGCTTCCACATCGTGGAAGG - Intronic
1065389044 10:25163564-25163586 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1066053782 10:31661683-31661705 CATATCAACCACATAAAGGATGG + Intergenic
1067068343 10:43115946-43115968 CAGAGCTGGCACATCAAGGGAGG + Intronic
1068484925 10:57645396-57645418 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1068499979 10:57832751-57832773 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1069364571 10:67684020-67684042 CAAAGCTTCCACAGCATGGAAGG + Intronic
1069371234 10:67749935-67749957 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1069526188 10:69174099-69174121 CAGAGCTTCCACAGTATGGAGGG - Intergenic
1069526393 10:69175721-69175743 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1069705458 10:70456598-70456620 CTGAGCTGCCCCATCAGGGATGG + Intergenic
1069967887 10:72136653-72136675 CAAAGCTTCCACAGCATGGAAGG - Intronic
1070430014 10:76328290-76328312 AAGAGCTACCAGATAAAGAACGG - Intronic
1070677790 10:78424362-78424384 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1071054250 10:81490712-81490734 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1072370695 10:94764161-94764183 CAAAGCTTCCACAGCATGGAAGG + Intronic
1072635796 10:97177051-97177073 CAGAGCCAGCACCTCTAGGATGG + Intronic
1072927073 10:99625231-99625253 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1073769339 10:106718599-106718621 CAAAGCTGCCACAGCATGGAAGG + Intronic
1074032198 10:109700102-109700124 CATAGCTCCCACAGCATGGAAGG - Intergenic
1074317299 10:112371183-112371205 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1074421335 10:113311320-113311342 CAGAGCTACTACAGAAAGGAAGG - Intergenic
1075130398 10:119733181-119733203 CAAAGCAAGCACATTAAGGAAGG + Intronic
1075254036 10:120910120-120910142 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1076260746 10:129063636-129063658 CAGAGTTATCACATTAAGAAAGG - Intergenic
1077302951 11:1855547-1855569 CTGAGAGACCACATCATGGAGGG - Intronic
1078414906 11:11156954-11156976 CAGGGGTACCAGATCAAGAAAGG - Intergenic
1078681937 11:13485540-13485562 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1079469788 11:20767260-20767282 CAAAGCTTCCACAGCATGGAAGG + Intronic
1079650244 11:22919644-22919666 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1079913383 11:26338548-26338570 CAAAGCTTCCACACCATGGAAGG - Intronic
1080003323 11:27376332-27376354 CAAATCTACCAAATAAAGGAAGG - Exonic
1080572175 11:33566407-33566429 CACAGCTATCAGATCATGGAAGG - Intronic
1080733037 11:34980403-34980425 CAAAGCTTCCACAGCATGGAAGG + Intronic
1081033841 11:38116963-38116985 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1082620838 11:55419958-55419980 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1082948985 11:58790141-58790163 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1083090039 11:60190286-60190308 CAAAGTTACCACAGCATGGAAGG - Intergenic
1083125828 11:60564752-60564774 CAAAGCTTCCACAGCATGGAGGG - Intergenic
1084221234 11:67680965-67680987 CAGATCCTCCAAATCAAGGATGG + Intronic
1084437089 11:69149392-69149414 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1084763860 11:71294756-71294778 CATAGCCACCACATCTGGGAAGG + Intergenic
1084840608 11:71843407-71843429 CAAAGTTCCCACATCATGGAAGG + Intergenic
1087075708 11:94125663-94125685 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1087156482 11:94909774-94909796 CCCAGATCCCACATCAAGGAAGG - Intergenic
1087349324 11:97011276-97011298 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1088120074 11:106358555-106358577 CAGAACTTCCAAAGCAAGGATGG + Intergenic
1088239721 11:107760653-107760675 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1088493254 11:110406734-110406756 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1090513152 11:127396827-127396849 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1091295989 11:134474358-134474380 CAGGGCTCTCACATCAGGGAGGG - Intergenic
1091778319 12:3198970-3198992 CAGAGCTACCACAACAGGCATGG - Intronic
1092276806 12:7067625-7067647 CACAGCTACCAGACGAAGGAAGG - Exonic
1092714313 12:11372737-11372759 CAAAGCTTCCACAGCATGGAAGG + Intronic
1092718027 12:11411758-11411780 CAAAGCTTCCACAGCATGGAAGG + Intronic
1094238492 12:28194999-28195021 CAAAGCTTCCACAGCATGGAAGG + Intronic
1094736541 12:33241043-33241065 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1097211866 12:57377003-57377025 CAAAGCTTCCACAGCATGGAAGG - Intronic
1097428653 12:59475815-59475837 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1098956208 12:76692548-76692570 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1098956943 12:76697452-76697474 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1099377190 12:81905514-81905536 CAAAGCTTCCACAGCACGGATGG - Intergenic
1099415052 12:82374276-82374298 CAAAGCTTCCACAGCATGGAAGG + Intronic
1099576471 12:84390288-84390310 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1099577189 12:84395438-84395460 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1099797816 12:87421212-87421234 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1100027481 12:90147726-90147748 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1100050477 12:90443492-90443514 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1100210537 12:92394027-92394049 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1100422866 12:94454623-94454645 CAGAGCTTCCACGGCATGGAAGG - Intronic
1100528743 12:95445088-95445110 CAAAGCTTCCACACCATGGAAGG + Intergenic
1101050722 12:100861010-100861032 CAAAGCTTCCACAGCATGGAAGG + Intronic
1101536622 12:105623740-105623762 CAGAGGGGCCACACCAAGGAGGG - Intergenic
1102150268 12:110684830-110684852 CAGAGCGACCACTTCTGGGAAGG - Intronic
1104762015 12:131302671-131302693 CAGAGCTACTGCATTAAGGGAGG - Intergenic
1104766789 12:131335224-131335246 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1104817760 12:131658113-131658135 CAGAGCTACTGCATTAAGGGAGG + Intergenic
1104921438 12:132292685-132292707 CAGAGCTACAGCATCCAGCAGGG + Intronic
1105437116 13:20388894-20388916 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1106162356 13:27212718-27212740 CAAAGCTTCCACAACATGGAAGG - Intergenic
1106471095 13:30054904-30054926 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1106708762 13:32309618-32309640 CAGAGATAGCACAGGAAGGAGGG - Intronic
1108113496 13:47102764-47102786 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1108118891 13:47161402-47161424 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1108735475 13:53279154-53279176 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1108848309 13:54700685-54700707 CAAAGCTTCCACATCACGGAAGG - Intergenic
1108867675 13:54941545-54941567 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1108958305 13:56188186-56188208 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109424023 13:62149279-62149301 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109425212 13:62158068-62158090 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109501140 13:63236970-63236992 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109534030 13:63693275-63693297 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1110078222 13:71277088-71277110 CAGAGACACCACCTCATGGAAGG + Intergenic
1110256412 13:73438609-73438631 CAGAGCTACCACAGTTATGAAGG + Intergenic
1111017234 13:82397261-82397283 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1111221053 13:85205755-85205777 AAGATCTACCACAGCATGGAAGG - Intergenic
1111250541 13:85595521-85595543 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1111409826 13:87860287-87860309 CATATCCACAACATCAAGGATGG - Intergenic
1111710211 13:91802479-91802501 CAAAGCTTCCACAGCATGGAAGG + Intronic
1111971119 13:94917916-94917938 CAGAGCTACCTCATGCAGGATGG + Intergenic
1112203310 13:97299994-97300016 CAGAACTACCACAATATGGAAGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112408232 13:99139529-99139551 CAGACCCTCCAAATCAAGGATGG - Intergenic
1112635041 13:101207812-101207834 CAAAGCTTCCACAGCACGGAAGG - Intronic
1113204236 13:107897246-107897268 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1113480005 13:110613865-110613887 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1115285825 14:31712048-31712070 CAAAGCTTCCACAGCATGGAAGG + Intronic
1115421216 14:33198224-33198246 CAAAGCTTCCACAGCATGGAAGG + Intronic
1115736902 14:36342132-36342154 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1116305290 14:43246132-43246154 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1116346858 14:43804625-43804647 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1118558773 14:67056077-67056099 CAAAGCTTCCACAGCATGGAGGG + Intronic
1120103765 14:80472149-80472171 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1120169845 14:81237155-81237177 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1121154341 14:91668565-91668587 CAAAGCTTCCACAGCATGGAAGG - Intronic
1122039413 14:98973204-98973226 CAGGGCTACCTTATCAAGGATGG - Intergenic
1122107017 14:99465658-99465680 CACAGCCACCACATCAAGGCAGG + Intronic
1124031653 15:26017754-26017776 CAAAGCTTCCACATCACAGAAGG + Intergenic
1125264604 15:37864613-37864635 CAAAGCTTCCACAGCACGGAAGG - Intergenic
1126188155 15:45850880-45850902 CGGAGCTGCCACAGCATGGAAGG + Intergenic
1126723948 15:51611965-51611987 CAAAGCTTCCACAGCATGGAAGG - Intronic
1126778881 15:52121166-52121188 CAGAGCTACCACTAGAAGAAGGG + Exonic
1126866946 15:52947154-52947176 CAGAGCTAGCACACCAGTGATGG + Intergenic
1127093271 15:55487503-55487525 CAAAGCTTCCACAGCATGGAAGG - Intronic
1130028518 15:80291152-80291174 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1131008001 15:88994140-88994162 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1131198373 15:90375425-90375447 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1131710301 15:95047004-95047026 CAAAGCTTCCACACCATGGAAGG + Intergenic
1131719159 15:95148433-95148455 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1133304185 16:4799702-4799724 CAGAGCTACCAGTTCAAGACGGG - Exonic
1135224484 16:20643627-20643649 CAAAGCTTCCACAGCAGGGAAGG + Intronic
1136590753 16:31216365-31216387 CAAAGCTTCCACAGCATGGAAGG - Intronic
1137521111 16:49196120-49196142 CACAGCTACCTCATCAGGGCTGG - Intergenic
1138014080 16:53413285-53413307 GAGAGCTTCCACATCCTGGAAGG - Intergenic
1138633087 16:58314993-58315015 CAGACCCTCCAAATCAAGGATGG + Intronic
1142200220 16:88757583-88757605 CAGGGCTTCCACACCCAGGAAGG + Intronic
1142328643 16:89435384-89435406 CACAGCTCCCACAGCATGGAAGG - Intronic
1143186547 17:5013701-5013723 CTGCTCTACCACATCAAAGATGG + Exonic
1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG + Intergenic
1144662919 17:17082940-17082962 CAGACCTACCACAATCAGGAGGG - Intronic
1144723361 17:17487319-17487341 CAAAGCTTCCACAGCATGGAAGG - Intronic
1144957547 17:19026742-19026764 CAGAGCCACAACAGCAAGAAAGG + Intronic
1144977609 17:19147774-19147796 CAGAGCCACAACAGCAAGAAAGG - Intronic
1145935624 17:28713056-28713078 TAGAGCTACCACGGGAAGGAGGG - Intergenic
1146295115 17:31643453-31643475 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1146772025 17:35577944-35577966 CTGTGCTACCACCTCAAAGATGG + Exonic
1149811059 17:59672590-59672612 CAGATTTTCCACATTAAGGAAGG - Intronic
1152420033 17:80187729-80187751 CAGGGCTGCCACACCCAGGACGG + Intronic
1152748789 17:82053071-82053093 CTGTGCCACCACATCAGGGAGGG - Intronic
1153300484 18:3587610-3587632 CAAAGCTTCCACAGCATGGAAGG - Intronic
1153438444 18:5090800-5090822 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1155785807 18:29898335-29898357 CAAAGCTTCCACAGCATGGATGG + Intergenic
1155966238 18:32037966-32037988 CAAAGCTCCCACAACATGGAAGG - Intronic
1156547530 18:37979650-37979672 CAGAGCTGACACTTCCAGGAGGG + Intergenic
1158207838 18:55013276-55013298 CAGAACTATCACACCAAAGATGG - Intergenic
1158744134 18:60178264-60178286 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1164029550 19:21390053-21390075 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1165415392 19:35690596-35690618 CAAAGCTACCACAGCACGGAAGG + Intergenic
1165558007 19:36652742-36652764 CAAAGCTTCCACAGCATGGAAGG - Intronic
1165798410 19:38532668-38532690 CAGAGCTGCCACCTGGAGGAGGG + Exonic
1165846757 19:38822858-38822880 CAGAGCTTCCATAGCATGGAAGG - Intronic
1166327936 19:42062634-42062656 CAGATCCCCCACATCAAGGTGGG - Exonic
1167685350 19:50952620-50952642 CAGAGCACCCACATCCAGGGGGG + Exonic
925023801 2:592475-592497 CAGAGCTCCCATACAAAGGAAGG - Intergenic
925952806 2:8930903-8930925 CAAAGCTTCCACAGCATGGAAGG - Intronic
925988056 2:9231789-9231811 CAGAGCTAAAACCTCAAGGATGG - Intronic
926284024 2:11473126-11473148 CAGAGCTGCCACATGAACGCTGG + Intergenic
926404430 2:12536474-12536496 CTGAGTTGCCACATCATGGAAGG + Intergenic
927096346 2:19750298-19750320 CAGGGCTACCAGTCCAAGGAAGG + Intergenic
927777949 2:25916477-25916499 CAAAGCTTCCACAGCATGGAAGG - Intergenic
927865368 2:26584425-26584447 CAGAGCTACCACATCGGGACAGG - Intronic
928106683 2:28475080-28475102 CAAAGCTTCCACAGCATGGAAGG + Intronic
928452698 2:31390798-31390820 CACAGCTACCTCACCAAAGAAGG - Intronic
928595936 2:32858835-32858857 CAAAGCTTCCACAGCATGGAAGG + Intergenic
929254179 2:39791609-39791631 CAAAGCTTCCACAGCATGGAAGG + Intergenic
930443319 2:51437062-51437084 CAAAGCTTCCACACCATGGAAGG - Intergenic
931401764 2:61937893-61937915 CAGACCCTCCAAATCAAGGATGG - Intronic
931470699 2:62535605-62535627 CAAAGCTTCCACACCATGGAAGG + Intergenic
931540130 2:63322361-63322383 CAAAGCTTCCACAGCATGGAAGG - Intronic
931583363 2:63801465-63801487 CAAAGCTCCCACAGCATGGAAGG + Intronic
932610722 2:73197676-73197698 GAGGGCCACCACTTCAAGGAAGG - Intergenic
932917164 2:75871955-75871977 CAGAGCTCCCATATAAAGGGAGG - Intergenic
933221637 2:79696564-79696586 CAGACCCTCCAAATCAAGGATGG - Intronic
933489456 2:82967226-82967248 CAAAGCTTCCACACCATGGAAGG + Intergenic
935171719 2:100615411-100615433 CAGAGCTGCCCCTTCATGGAGGG + Intergenic
935789402 2:106577291-106577313 CAAAGCTTCCACAGCATGGAAGG + Intergenic
936803046 2:116289440-116289462 CAAAGCTTCCACAGCATGGAAGG - Intergenic
937594962 2:123661468-123661490 CAGAGCTCCCATATCATGGGAGG - Intergenic
938315980 2:130328207-130328229 CAAACCTTCCACAGCAAGGAAGG - Intergenic
938806530 2:134811373-134811395 CAAAGCTTCCACAGCATGGAAGG + Intergenic
938911423 2:135888884-135888906 CAAAGCTTCCACAGCATGGAAGG - Intergenic
939255883 2:139744242-139744264 CAAAGCTTCCACAGCATGGAAGG - Intergenic
939292178 2:140210813-140210835 TAGAGTGAACACATCAAGGATGG - Intergenic
939551928 2:143626528-143626550 CAAAGCTTCCACAGCATGGAAGG + Intronic
941313518 2:163964177-163964199 CAAAGCTTCCACAGCATGGAAGG + Intergenic
942294178 2:174501625-174501647 CAGAACCTCCACATCAAGGGTGG - Intergenic
942425637 2:175857623-175857645 CAGAACTTCCACAGCATGGAAGG - Intergenic
943103388 2:183512763-183512785 CAAAGCTTCCACAGCATGGAAGG + Intergenic
943440522 2:187922364-187922386 CAGACCTTCCAAATCAAAGATGG + Intergenic
943577735 2:189651020-189651042 CAAAGCTTCCACAGCATGGAAGG - Intergenic
944053110 2:195493770-195493792 CAAAGCTTCCACAGCATGGAAGG - Intergenic
944129609 2:196333233-196333255 CAGACCTACGAGATCAATGACGG + Intronic
944362123 2:198869537-198869559 CAAAGCTACCACACCCTGGAAGG + Intergenic
945289902 2:208116626-208116648 CAAAGTTACCACAGCATGGAGGG - Intergenic
945600856 2:211863393-211863415 CAAAGCTTCCACAGCATGGAAGG - Intronic
945869281 2:215208667-215208689 CAAAGCTTCCACAGCATGGAAGG - Intergenic
948643427 2:239389267-239389289 CAAAGCTTCCACAGCATGGAAGG - Intronic
948864217 2:240767275-240767297 CTGCTCTACTACATCAAGGATGG - Exonic
949038897 2:241835891-241835913 CAAAGCTTCCACACCATGGAAGG + Intergenic
1169647757 20:7833038-7833060 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1169647954 20:7834490-7834512 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1170986541 20:21264567-21264589 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1171288259 20:23961452-23961474 CAGACCTTCTAAATCAAGGATGG - Intergenic
1173746210 20:45439173-45439195 CAGACCCTCCAAATCAAGGAAGG + Intergenic
1174492584 20:50911666-50911688 CAGAGCTACCACATCAAGGATGG + Intronic
1175191831 20:57216701-57216723 CAGAGCTCCCACATAGGGGAAGG + Intronic
1177140717 21:17354673-17354695 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1177715917 21:24839995-24840017 GAAAGCTACCACAGCATGGAAGG + Intergenic
1177967911 21:27751395-27751417 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1177978776 21:27884957-27884979 CAAAGCCACCACAGCATGGAAGG + Intergenic
1178935408 21:36857636-36857658 CAGAGCTCCCACTCCTAGGATGG + Intronic
1179236155 21:39548211-39548233 CTCAGCTACAACATGAAGGATGG - Intergenic
1180740887 22:18052721-18052743 CAAAGCTATCACACTAAGGAAGG + Intergenic
1180755229 22:18156372-18156394 CAAAGCTTCCACAGCATGGAAGG - Intronic
1182852386 22:33486446-33486468 CAGAGCATCAACATCAAGCATGG + Intronic
1183048384 22:35240561-35240583 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1183678689 22:39314171-39314193 CAGGGCTACCTTATCAAGGACGG - Exonic
1184252316 22:43267844-43267866 CAGAGATACCACCTGCAGGAGGG - Intronic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1185194567 22:49460988-49461010 CCGTGCTACCAAAACAAGGAGGG + Intronic
949449290 3:4167231-4167253 CAAAGCTTCCACAGCATGGAAGG + Intronic
949723273 3:7015174-7015196 CAAAGCTTCCACAGCAGGGAAGG - Intronic
950286922 3:11752319-11752341 CAAAGCTTCCACAGCATGGAAGG + Intergenic
950972810 3:17205842-17205864 TAAAGCTACCACACTAAGGATGG + Intronic
951682711 3:25311200-25311222 CAGGACAACCACCTCAAGGAGGG + Intronic
952941273 3:38446084-38446106 CAAAGCTTCCACAGCATGGAAGG + Intergenic
953515815 3:43591087-43591109 CAGAGCTACCATATGATGGCAGG - Intronic
953623269 3:44550624-44550646 CAAAGCTTCCACAGCATGGAAGG + Intergenic
954089179 3:48271275-48271297 CAAAGCTTCCACAGCATGGAAGG + Intronic
954096978 3:48336201-48336223 CAGAGCTCCCATACAAAGGAGGG + Intergenic
954599453 3:51856652-51856674 CAAAGCTTCCACAGCATGGAAGG - Intergenic
954983766 3:54771053-54771075 CAGATCCACCACATCAACCAAGG - Intronic
955941821 3:64153253-64153275 CAGCGCTACATCATGAAGGAGGG - Exonic
956921525 3:73934898-73934920 CAGAGATCCCATATCAAGGGAGG + Intergenic
957445913 3:80312583-80312605 CACAGCTTCCACAGCATGGAAGG - Intergenic
957619364 3:82574810-82574832 CAAAGCTTCCACAGCATGGAAGG - Intergenic
957687033 3:83515184-83515206 CAGAGCTCCCACACAAAGGGAGG - Intergenic
957782309 3:84835121-84835143 CAAAGCTTCCACAACAGGGAAGG + Intergenic
958601728 3:96302721-96302743 CAAAGCTTCCACAGCATGGAAGG - Intergenic
958627590 3:96646177-96646199 CAAAGCTTCCACAGCATGGAAGG + Intergenic
959141484 3:102491843-102491865 CAAAGCTTCCACAACAGGGAAGG + Intergenic
959334412 3:105045968-105045990 CAAAGCTTCCACAGCATGGAAGG - Intergenic
959564310 3:107818759-107818781 CAAAGCTTCCACAGCATGGAAGG - Intergenic
960063358 3:113346842-113346864 CAAAGCTTCCACAGCATGGAAGG - Intronic
960064123 3:113352322-113352344 CAAAGCTTCCACAGCATGGAAGG - Intronic
963692794 3:148525689-148525711 CAAAGCTTCCACAGCATGGAAGG - Intergenic
963696393 3:148570912-148570934 CAAAGCTTCCACAGCATGGAAGG - Intergenic
963700333 3:148618103-148618125 CAAAGCTTCCACAGCATGGAAGG - Intergenic
963910598 3:150814356-150814378 CAGACCTTCCAAATCAAGGATGG - Intergenic
964222953 3:154367650-154367672 CAAAGCTTCCACAGCATGGAAGG - Intronic
964604886 3:158549958-158549980 CAAAGCTTCCACAGCATGGAAGG + Intergenic
964916278 3:161846079-161846101 CAAAGCTTCCACAGCATGGAAGG + Intergenic
965102112 3:164311101-164311123 CAAAGCTTCCACAGCATGGAAGG + Intergenic
965249072 3:166318708-166318730 CAAAGCTTCCACAGCATGGAAGG + Intergenic
968181450 3:196598548-196598570 CAGAGCTTCCACACAATGGAAGG + Intergenic
969781702 4:9409400-9409422 CAAAGTTCCCACATCATGGAAGG + Intergenic
970657339 4:18246176-18246198 CAAAGCTTCCACAGCAAGGAAGG + Intergenic
971171265 4:24235619-24235641 CAGAGCCACCAAATCAATAATGG + Intergenic
971329334 4:25669759-25669781 GAGAGCTTCCACTTCAAGAATGG + Exonic
971630567 4:28987924-28987946 CAAAGCTTCCACAGCATGGAAGG + Intergenic
971890995 4:32521767-32521789 CATAGCTTCCACAGCAAAGAAGG + Intergenic
972132776 4:35859071-35859093 CAAAGCTTCCACAGCATGGAAGG + Intergenic
972411276 4:38797364-38797386 TAAAGCTGCCACATCCAGGAAGG + Exonic
972414806 4:38827991-38828013 TAAAGCTGCCACATCCAGGAAGG + Exonic
973039802 4:45456481-45456503 CAAAGCTCCCACAGCATGGAAGG + Intergenic
973044599 4:45520010-45520032 CAAAGCTTCCACAGCATGGAAGG + Intergenic
974520966 4:62979226-62979248 CAAAGCTTCCACAGCATGGAAGG + Intergenic
974526206 4:63052890-63052912 CAAAGCTTCCACAGCATGGAAGG - Intergenic
974645713 4:64688433-64688455 CAAAGCTTCCACAGCATGGAAGG - Intergenic
975004221 4:69267487-69267509 CAAAGCTTCCACAGCATGGAAGG - Intergenic
975013384 4:69381493-69381515 CAAAGCTTCCACAGCATGGAAGG - Intronic
975208343 4:71669911-71669933 CAAAGCTTCCACAGCATGGAAGG - Intergenic
977250793 4:94686439-94686461 CAAAGCTTCCACAGCATGGAAGG - Intergenic
977367211 4:96085195-96085217 CAAAGCTTCCACAGCAGGGACGG - Intergenic
977370232 4:96126038-96126060 CAAAGCTACCACAGCATGGAAGG + Intergenic
977449922 4:97182350-97182372 CAAAGCTTCCACAGCATGGAAGG - Intergenic
977622397 4:99152507-99152529 CAGACCCTCCAAATCAAGGATGG + Intronic
978366695 4:107990105-107990127 CAGAGCTTCCACCTCAGGGTGGG - Intronic
979356378 4:119711169-119711191 CATAGTTACCACATCATGGGAGG + Intergenic
979648806 4:123106680-123106702 CAGAACTACCTCAGCAAAGAAGG + Intronic
981146587 4:141332577-141332599 CAGAGCCTCCACAGCATGGAAGG + Intergenic
981169435 4:141604999-141605021 CAAAGCTTCCACAACATGGAAGG + Intergenic
982036743 4:151353410-151353432 CAAAGCTACCACAGCATGAAAGG + Intergenic
982700767 4:158657964-158657986 CAAAGCTTCCACAGCATGGAAGG - Intergenic
982701831 4:158665441-158665463 CAAAGCTTCCACAGCATGGAAGG - Intergenic
982773056 4:159415616-159415638 CAAAGCTTCCACAGCATGGAAGG - Intergenic
983084700 4:163428502-163428524 CAAAGCTTCCACAGCATGGAAGG - Intergenic
983306369 4:165994457-165994479 CAGAGCCGCTACATCAAGAACGG + Exonic
983335491 4:166386330-166386352 AAGACCTACCATATCAAGGCAGG + Intergenic
983493114 4:168412153-168412175 CATAGCCACCACAGCTAGGAAGG - Intronic
983573492 4:169235420-169235442 CAGAGTTATCATATCATGGAAGG - Intronic
983990833 4:174117751-174117773 CAGAACTACCACCTCCAGCACGG - Intergenic
984404655 4:179312271-179312293 CAAAGCTTCCACAGCAAGGATGG - Intergenic
984409545 4:179378848-179378870 CAAAGCTACCACAGCGTGGAAGG + Intergenic
985322888 4:188734405-188734427 CAAAGCTTCCACACCATGGAAGG + Intergenic
985553563 5:545265-545287 CATAGCTTCCACAGCATGGAAGG - Intergenic
986152140 5:5138597-5138619 CAAAGCTTCCACAGCATGGAAGG - Intergenic
987476539 5:18399171-18399193 CAAAGCTTCCACATCGTGGATGG + Intergenic
987545606 5:19307398-19307420 CAAAGCTTCCACAGCATGGAAGG + Intergenic
987781363 5:22440591-22440613 TAGAGCAACCAGAACAAGGATGG - Intronic
988039917 5:25875963-25875985 CAAAGCTTCCACAGCATGGAAGG + Intergenic
988619128 5:32804535-32804557 CAAAGCTTCCACAGCATGGAAGG + Intergenic
988956804 5:36328728-36328750 CAGAGCTCCCACACAAAGGGAGG + Intergenic
990043756 5:51403016-51403038 CAAAGCTTCCACAGCATGGAAGG - Intergenic
990176356 5:53112616-53112638 CAAAGCTTCCACAGCATGGAAGG - Intergenic
990367295 5:55084407-55084429 CAAAGCTTCCACAGCATGGAAGG + Intergenic
990368220 5:55091069-55091091 CAAAGCTTCCACATCATGGAAGG + Intergenic
990441348 5:55848624-55848646 CAGAGATATAACATCAAGGATGG - Intergenic
990880352 5:60531132-60531154 CAAAGCTACCACAGCATGAAAGG - Intergenic
992455816 5:76914511-76914533 CAAAGCTTCCACAGCATGGAAGG - Intronic
992613877 5:78531642-78531664 CATTGCTACCCCATCAAGTAGGG - Intronic
992947583 5:81824514-81824536 CAAAGCTACCACACTATGGAAGG - Intergenic
993665761 5:90693931-90693953 CAGAGCCACTACATCAATGTCGG - Exonic
993768383 5:91892395-91892417 CAAAGCTCCCACAGCATGGAAGG + Intergenic
994230795 5:97309154-97309176 CAAAGCTTCCACAGCATGGAAGG + Intergenic
995529255 5:113075752-113075774 CAAAGCTTCCACAGCATGGAAGG - Intronic
995679038 5:114696375-114696397 CAAAGCTTCCACAGCACGGAAGG - Intergenic
995707446 5:114999808-114999830 CAAAGCTTCCACAGCATGGAAGG - Intergenic
996272048 5:121617229-121617251 CAAAGCTGCCACAGCATGGAAGG - Intergenic
996561411 5:124833489-124833511 TAGTGGTACCATATCAAGGAAGG + Intergenic
997772100 5:136564738-136564760 CAAAGCTTCCACAGCATGGAAGG - Intergenic
998339697 5:141405972-141405994 GAGAGCTACCCCATGAAGTATGG - Intronic
998658321 5:144206779-144206801 CAGCTCTACCACCTCAGGGAAGG - Exonic
998691827 5:144595679-144595701 CAAAACTTCCACATCATGGAAGG - Intergenic
999348701 5:150846539-150846561 CAAAGCTTCCACAGCATGGAAGG - Exonic
1001717940 5:173832313-173832335 CAGACCTACTGAATCAAGGAAGG + Intergenic
1004121040 6:12822410-12822432 GAGCGATACCACATGAAGGAGGG + Intronic
1004500865 6:16208867-16208889 CAGTGCTGCCATATCAAAGAAGG - Intergenic
1004685388 6:17938301-17938323 AAGACCTACCAAATGAAGGAAGG + Intronic
1004912779 6:20302266-20302288 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1005114134 6:22317879-22317901 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1005649948 6:27877359-27877381 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1006044289 6:31281172-31281194 TAGGGCTACCTTATCAAGGATGG + Intronic
1006900972 6:37500889-37500911 CAAAGCTCCCACATCATGGAAGG + Intergenic
1007749913 6:44065504-44065526 AAGTGCTACCACATCTAGGGTGG + Intergenic
1008218279 6:48822823-48822845 CAAAGCTTCCACATCATGGAAGG - Intergenic
1008270069 6:49481546-49481568 CAAAGCTTCCACAGCATGGAAGG + Intronic
1008946150 6:57099204-57099226 GAGAGTTACCAAATCAGGGAAGG + Intronic
1009687987 6:66988050-66988072 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1009688258 6:66991360-66991382 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1009946628 6:70348014-70348036 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1010074603 6:71785615-71785637 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1010307843 6:74345617-74345639 CACAGTTGCCACAGCAAGGATGG + Intergenic
1011210035 6:84945259-84945281 CAGAGCTCCCACACAAAGGCAGG - Intergenic
1011375384 6:86681212-86681234 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1012598346 6:101066046-101066068 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1012733435 6:102910253-102910275 CAAACCTTCCACCTCAAGGAAGG + Intergenic
1012738939 6:102989328-102989350 CAAAGCTTCCACATCGTGGAAGG + Intergenic
1012739685 6:103000597-103000619 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1013213169 6:108004682-108004704 CAGGGCTACCTTATCAAGGATGG - Intergenic
1013410496 6:109879499-109879521 CAGAGCTCCCACACCAAGGGAGG - Intergenic
1013738969 6:113260676-113260698 CTCAGCCACCACATCCAGGAAGG - Intergenic
1013906905 6:115231902-115231924 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1013977073 6:116091388-116091410 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1014201873 6:118617649-118617671 CAAAGCTTCCACAGCATGGAAGG - Intronic
1014351910 6:120356382-120356404 ATGAGCCACCACATCAAGGCTGG - Intergenic
1016248405 6:142015219-142015241 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1016652946 6:146484018-146484040 CAAAGCTTCCACAGCACGGAAGG - Intergenic
1016677866 6:146793013-146793035 CAAAGCTTCCACAACATGGAAGG + Intronic
1016784548 6:147995760-147995782 CAGGACTACCAGAGCAAGGAAGG + Intergenic
1017100938 6:150849354-150849376 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1017358763 6:153541764-153541786 CAGAGCCCCCGCATCAAGGATGG + Intergenic
1017380399 6:153821685-153821707 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1017537532 6:155364082-155364104 CAAAGCTTCCACAGCACGGAAGG - Intergenic
1017742667 6:157420754-157420776 AAGAGAGACAACATCAAGGACGG + Intronic
1017969526 6:159299631-159299653 CTGAGCTTCCTCATCAGGGAAGG - Intergenic
1020865007 7:13549128-13549150 CAGAGCTACAATATCAAAAAAGG + Intergenic
1021347868 7:19549562-19549584 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1022679084 7:32527111-32527133 CAGACCCTCCAAATCAAGGATGG + Intronic
1023151418 7:37204553-37204575 CAAAGCTTCCACAGCATGGAAGG + Intronic
1023520002 7:41040324-41040346 CAGACCTACCTGATGAAGGAGGG + Intergenic
1023546053 7:41318571-41318593 CAAAGCTACCACAGCATGGAAGG + Intergenic
1023735863 7:43235295-43235317 CAGAGGTCCCCCATCAAGGAGGG - Intronic
1023911691 7:44560963-44560985 AAGAGCTCCCACATCAAGGTGGG + Intergenic
1024091102 7:45940467-45940489 CAAAGCTTCCACACCATGGAAGG - Intergenic
1024285313 7:47752026-47752048 CAAAGCTTCCACAGCATGGAAGG - Intronic
1024331886 7:48163051-48163073 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1024871149 7:53962727-53962749 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1026486104 7:70822829-70822851 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1027790758 7:82637160-82637182 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1027791966 7:82645634-82645656 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1028013978 7:85684008-85684030 CAGAGCTCCCACACAAAGGGAGG - Intergenic
1030010884 7:105165785-105165807 CAAAGCTTCCACAGCATGGAAGG - Intronic
1030420856 7:109304522-109304544 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1031732403 7:125315159-125315181 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1034219425 7:149432557-149432579 CAGCGCAACCACATCAAGGAGGG - Exonic
1034579234 7:152028136-152028158 CAAAGCTTCCACAGCATGGAAGG + Intronic
1037159070 8:15745182-15745204 CATATATACCACATCAATGACGG - Intronic
1037173832 8:15924393-15924415 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1037571278 8:20159583-20159605 CAGAGCTACCATATAATGGGAGG - Intronic
1038430004 8:27492604-27492626 CAAAGCTTCCACAGCATGGAAGG + Intronic
1039129645 8:34248420-34248442 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1039635247 8:39157845-39157867 CAGGGCTACTTCATCAAGGATGG - Intronic
1040526826 8:48233104-48233126 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1040971798 8:53143213-53143235 CAAAGCTTCCACAGCACGGAAGG + Intergenic
1040999510 8:53437074-53437096 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1041000282 8:53442790-53442812 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1041001536 8:53459645-53459667 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1041435902 8:57841396-57841418 CAAAGCTTCCACAGCACGGAAGG - Intergenic
1041818708 8:62004183-62004205 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1042919268 8:73906349-73906371 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1042933387 8:74034858-74034880 CAGATCCTCCAAATCAAGGATGG + Intergenic
1042948623 8:74178961-74178983 CAAAGCTCCCACAACATGGAAGG + Intergenic
1043127744 8:76421211-76421233 CAGAGGTACCACAGCATGGCAGG + Intergenic
1043369183 8:79571476-79571498 CAGAGCTACCTTATCAAGGGTGG - Intergenic
1043526862 8:81106554-81106576 CAGTCCTATAACATCAAGGATGG + Intronic
1043703377 8:83318916-83318938 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1044679088 8:94759152-94759174 CAAAGCTTCCACAGCATGGAAGG + Intronic
1045585108 8:103525929-103525951 GAGAGCTAACACATCAATGAAGG + Intronic
1045589000 8:103572257-103572279 CAAAGCTTCCACAGCATGGAAGG + Intronic
1045788645 8:105955668-105955690 CAGAGCTACCATACAAAGGGAGG + Intergenic
1046260183 8:111758285-111758307 CAAAGCTTCCCCATCACGGAAGG + Intergenic
1046329736 8:112699127-112699149 CAAAGCTTCCACAGCATGGAAGG - Intronic
1046337808 8:112813202-112813224 CAAAGCTCCCACAGCATGGAAGG + Intronic
1048187236 8:132252544-132252566 CAAAGCTTCCACAGCACGGAAGG + Intronic
1048210423 8:132450103-132450125 CAAAGCTTCCACAGCATGGAAGG + Intronic
1048818945 8:138361805-138361827 CAGAGCTGTCACTTTAAGGATGG - Intronic
1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG + Intronic
1049827106 8:144676116-144676138 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1049944020 9:577145-577167 CAAAGCTTCCACAGCATGGAAGG + Intronic
1050835422 9:10072501-10072523 CACAGCTTCCACAGCATGGAAGG + Intronic
1051680377 9:19601405-19601427 CAAAGCTTCCACAGCAAGGAAGG - Intronic
1051968783 9:22862756-22862778 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1052058159 9:23925868-23925890 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1052203257 9:25808062-25808084 CAAAGCTTCCACATCGTGGAAGG + Intergenic
1053411820 9:37920727-37920749 CAGTGCCACCAGATGAAGGAAGG - Intronic
1053860142 9:42378430-42378452 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1055075534 9:72211625-72211647 CAGAACTACGACATCTGGGAAGG + Intronic
1055241769 9:74194911-74194933 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1055431350 9:76247331-76247353 CAGAGCTCCCATATAAAGGGAGG + Intronic
1055458626 9:76495443-76495465 CAGAGCTTCCACAGCATGGAAGG + Intronic
1056391815 9:86147818-86147840 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1056625548 9:88250142-88250164 CACAGCTACCACATCCAGACGGG + Intergenic
1057343522 9:94225761-94225783 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1057382422 9:94581276-94581298 CAGAGCCTCCAAATCCAGGACGG + Intronic
1057547668 9:96030333-96030355 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1058446233 9:105057748-105057770 CAGACCCTCCAAATCAAGGATGG + Intergenic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1061437957 9:130578820-130578842 CAGATCTTCTACAGCAAGGAAGG - Intergenic
1185909900 X:3971699-3971721 CAAAGTTACCACAGCATGGAGGG - Intergenic
1186254542 X:7704027-7704049 CAGAGCTCCCACACAAAGGGAGG + Intergenic
1186465839 X:9784409-9784431 CAAAGCTTCCACAGCATGGAAGG + Intronic
1187010508 X:15273722-15273744 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1188176937 X:27002430-27002452 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1188248035 X:27857460-27857482 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1189810741 X:44778618-44778640 CAAAGCTTCCACACCATGGAAGG - Intergenic
1189902291 X:45718925-45718947 CATAGATACCAGATGAAGGATGG + Intergenic
1190541066 X:51479669-51479691 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1191161440 X:57333672-57333694 CAGATCTTCCACATCACCGAAGG - Intronic
1192065654 X:67881933-67881955 CAGACCCTCCAAATCAAGGATGG - Intergenic
1192130061 X:68541443-68541465 CAAAGCTTCCACATCATGGAAGG + Intergenic
1192676284 X:73199962-73199984 CAGATCCTCCAAATCAAGGATGG + Intergenic
1193143799 X:78056949-78056971 CAGAGCTTACATATAAAGGAAGG - Intergenic
1193941036 X:87681268-87681290 CAAAGCTCCCACAGCATGGAAGG - Intergenic
1193951632 X:87808196-87808218 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1194034225 X:88851763-88851785 CAGACCTTCCAAATCAAGCATGG + Intergenic
1194408958 X:93533220-93533242 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1194501284 X:94684696-94684718 CAGACCCTCCAAATCAAGGATGG - Intergenic
1195440913 X:104896720-104896742 CAAAGCTTCCACAGCATGGAAGG - Intronic
1195579947 X:106490178-106490200 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1195850565 X:109277885-109277907 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1196108329 X:111919362-111919384 CAAAGCTTCCACAGCATGGAAGG - Intronic
1197091164 X:122539116-122539138 CAGGGCTACCCTATCATGGACGG + Intergenic
1197209435 X:123816721-123816743 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1197398743 X:125962165-125962187 CAAAGCTTCCACAGCATGGAGGG + Intergenic
1197513026 X:127395093-127395115 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1198860917 X:141069595-141069617 CCCAGCTCCCACTTCAAGGAAGG + Intergenic
1198901775 X:141517788-141517810 CCCAGCTCCCACTTCAAGGAAGG - Intergenic
1199120801 X:144051380-144051402 CAGAGATACAACAACAAGAAAGG + Intergenic
1200394138 X:155973401-155973423 CAAAGTTACCACAGCATGGAGGG + Intergenic
1200694527 Y:6347183-6347205 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1200711728 Y:6490678-6490700 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1200749384 Y:6930834-6930856 CAAAGCTGCCACAGCATGGAAGG - Intronic
1200750328 Y:6939026-6939048 CAAAGCTGCCACAGCATGGAAGG + Intronic
1200775900 Y:7170177-7170199 CAAAGCTTCCACAGCATGGACGG - Intergenic
1200850353 Y:7876835-7876857 GAGACATACCACATAAAGGATGG + Intergenic
1201022208 Y:9671302-9671324 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201040750 Y:9827527-9827549 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201275833 Y:12297696-12297718 CAGACCCTCCAAATCAAGGATGG - Intergenic
1201279140 Y:12326014-12326036 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201404636 Y:13637114-13637136 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201406655 Y:13656990-13657012 CAAAGCTTCCACAGCAAGGAAGG + Intergenic
1201421467 Y:13804444-13804466 CAGAGCTCCCACATGAAGGGAGG - Intergenic
1201509107 Y:14737947-14737969 CATAGTTACCACAGCAAGAATGG - Intronic
1201632123 Y:16080484-16080506 CAAAGCTTCCACAACATGGAAGG - Intergenic
1201644021 Y:16207713-16207735 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201652918 Y:16310817-16310839 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201658794 Y:16377608-16377630 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201744310 Y:17353782-17353804 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201750295 Y:17423960-17423982 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201910803 Y:19131899-19131921 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201913318 Y:19155895-19155917 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201981381 Y:19913801-19913823 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201985685 Y:19962388-19962410 CAAAGCTCCCACAGCATGGAAGG + Intergenic
1202242519 Y:22786181-22786203 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1202258455 Y:22944241-22944263 CAGAGCTTCCACAGCATGGAAGG - Intergenic
1202395504 Y:24419930-24419952 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1202411445 Y:24577999-24578021 CAGAGCTTCCACAGCATGGAAGG - Intergenic
1202459338 Y:25092073-25092095 CAGAGCTTCCACAGCATGGAAGG + Intergenic
1202475280 Y:25250162-25250184 CAAAGCTTCCACAGCATGGAAGG + Intergenic