ID: 1174497120

View in Genome Browser
Species Human (GRCh38)
Location 20:50955231-50955253
Sequence ATGGAAGCCCAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174497120 Original CRISPR ATGGAAGCCCAGATGGAACA AGG (reversed) Exonic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
905338530 1:37262099-37262121 ACGGAAGCCCCCATGGAAAATGG - Intergenic
905616068 1:39400028-39400050 AAGGAAGCCCAGAAGAAAGATGG - Intronic
907040650 1:51256208-51256230 AGGGATGAACAGATGGAACACGG - Intronic
907713391 1:56905306-56905328 ATGGAGGCCCAGTGGGATCATGG + Intronic
914084681 1:144442666-144442688 ATGGCGGCCCAGATGGAAGGTGG - Exonic
914327602 1:146635534-146635556 AAGGAGGCCCAAATGGAAGATGG - Intergenic
917871881 1:179249368-179249390 AAGGAAGACCAGAGGGAGCATGG + Intergenic
919841084 1:201609877-201609899 AGGGAAACCTGGATGGAACAGGG + Intergenic
919880863 1:201899654-201899676 ATGGTAGCCCAGCTTGAGCAGGG + Exonic
920133810 1:203753575-203753597 AGAGAACCCCAGAAGGAACAAGG + Intergenic
921008059 1:211113551-211113573 ATGGAAGAGGAGAAGGAACAGGG + Intronic
922712176 1:227842538-227842560 GTGGAAGGCCAGATGGGGCAGGG - Intronic
923366834 1:233270036-233270058 ATGGATGACCAGATGGACAAAGG - Intronic
923438669 1:233994554-233994576 ATGAAAGTCAAGAAGGAACAAGG - Intronic
924827473 1:247555947-247555969 ATGGATGCCCACATGCAGCAGGG + Intronic
1063434830 10:6021347-6021369 ATGGAAGCCCAGGGAGATCAAGG + Intronic
1065679193 10:28211830-28211852 ATGGGAGCCCAGATCACACAGGG + Intronic
1065684145 10:28267024-28267046 ATGGCAGAACAGATGGCACACGG - Intronic
1066208209 10:33210518-33210540 ATGAAAACCCATATGGAACTAGG + Intronic
1066258387 10:33704188-33704210 GCAGAAGCCCAGATGGATCAGGG + Intergenic
1069070675 10:63987934-63987956 ATGGCAGACCAGAGTGAACAGGG - Intergenic
1069471584 10:68696517-68696539 TTGGAAGCCCAGAAGAAATAGGG - Intergenic
1069479073 10:68764200-68764222 ATTGAAACCCAGATGGAGCAAGG - Intronic
1069693683 10:70371620-70371642 ACGGAAACCCAGATGGAAAAGGG + Intronic
1070121872 10:73585444-73585466 AGGGAAGCCCAGGTGTCACATGG + Intronic
1070430450 10:76332636-76332658 ATGGAAGCCTAGAATGTACAGGG + Intronic
1074629987 10:115242236-115242258 ATGGAAACCCAGATGTATCTGGG + Intronic
1075397200 10:122136072-122136094 ACAGAAGCACACATGGAACAAGG + Intronic
1075467227 10:122660872-122660894 ATGAAAGCCTTGAAGGAACAGGG + Intergenic
1075665859 10:124230422-124230444 GTGGAATACCATATGGAACACGG - Intergenic
1076470069 10:130712313-130712335 ATGGAAACTTACATGGAACAAGG + Intergenic
1076662967 10:132067715-132067737 ATGGAAGCCCAGAGTCCACACGG - Intergenic
1082105338 11:48215443-48215465 ATGGAAGCACAAGTGGAAGAAGG + Intergenic
1084638238 11:70407634-70407656 ATGGAGCCCCAGGTGCAACAGGG + Intronic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1088442120 11:109882385-109882407 ATGGAAGCAGAGATGTAAGAAGG - Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1090481894 11:127076338-127076360 ATGGAAGCCCAGGGAGCACAGGG + Intergenic
1091232491 11:133997847-133997869 AAGGAAGCCCAAAAGGAACTGGG - Intergenic
1092051769 12:5475992-5476014 ATGGAGGCCCTGATGGAAGAAGG + Intronic
1092106877 12:5927570-5927592 TTGGAAGCCCTGATGGTAGATGG - Intronic
1092154451 12:6273517-6273539 AGGGAAGTCCACAAGGAACAAGG + Intergenic
1092860341 12:12714753-12714775 ATGGAGTCCCTGAAGGAACAGGG - Intergenic
1094058976 12:26293410-26293432 AAGCAAGGCCAGAAGGAACAAGG + Intronic
1095744711 12:45644795-45644817 AGGAAAGCCCAGATGGTTCAAGG + Intergenic
1096018671 12:48303293-48303315 ATGGAATACAAGAGGGAACAAGG + Intergenic
1097021660 12:56025198-56025220 ATTGAAGGCCAAATGCAACAGGG - Intronic
1101492502 12:105222498-105222520 GTGGAAGGCCAGATGGAGAACGG + Intronic
1103479032 12:121239084-121239106 ATGGAAGCCAAGAAGGCCCAGGG + Exonic
1104420497 12:128630607-128630629 ATGACCGCCCAGAGGGAACATGG - Intronic
1106124014 13:26885365-26885387 ATGGAAGCCTTGATAGAAGAGGG + Intergenic
1106979786 13:35265243-35265265 ATGAAAACCCATATGGATCATGG + Intronic
1107274284 13:38659380-38659402 ATGGCAGCACAGATGAAACATGG - Intergenic
1111353240 13:87061559-87061581 ATAGAAGCTCAGTTGGTACACGG + Intergenic
1112485597 13:99816825-99816847 ATAGAAGCCCACATGGACTAAGG + Intronic
1112688787 13:101864764-101864786 ATGGAAGCACTGATGGCACCAGG + Intronic
1115012348 14:28564541-28564563 ATGGAATCCTGGATGGAACGAGG + Intergenic
1115352155 14:32407141-32407163 AGGAAAGCCAAGATGGAAAAAGG - Intronic
1116649156 14:47566879-47566901 ATGGATGACTAGATGCAACAAGG - Intronic
1117969150 14:61235176-61235198 AGGGATGCCCATATGGAGCATGG - Intronic
1119473312 14:74912427-74912449 CTGGAGGTCCAGTTGGAACAGGG - Intronic
1119675313 14:76549115-76549137 AAGAAAGCCCAGGTGGGACAGGG - Intergenic
1121971701 14:98363663-98363685 AAGGAATCCAAGATGGTACAAGG + Intergenic
1128654143 15:69447065-69447087 ATGGAGGCCCAGATAGTCCAAGG - Intronic
1130011767 15:80157874-80157896 CTGGAAGCAGAGATGGCACAAGG + Intronic
1130943331 15:88530328-88530350 ATGGAAGCCCAAATGCTACAAGG - Intronic
1134600429 16:15529367-15529389 ATGGCAGCCCAAATGGACTAAGG + Intronic
1135034849 16:19068332-19068354 AAGGCAGCACAGATGAAACAAGG - Intronic
1135149486 16:19993127-19993149 ATGGAAATCCAGATGGCACCAGG - Intergenic
1138452588 16:57102507-57102529 AGGGAAGCCCAGAGAGACCATGG - Intronic
1140005957 16:71075406-71075428 AAGGAGGCCCAAATGGAAGATGG + Intronic
1140141288 16:72260448-72260470 ATGGAATAACTGATGGAACAGGG + Intergenic
1140465163 16:75175324-75175346 ATGTAAGCCCCCATGGAACAAGG + Intergenic
1140476559 16:75242084-75242106 ACGTAAACCCAGATGGCACAGGG + Intronic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1140858103 16:78995495-78995517 ATGGAACCCAAGCTGGAACTTGG + Intronic
1203143147 16_KI270728v1_random:1782105-1782127 GTGGATCCCCAGATGGAAGATGG + Intergenic
1144278940 17:13704970-13704992 GTTGAAGCCCAGATTGACCAAGG - Intergenic
1146226653 17:31072739-31072761 ATTGAGGCCCACAGGGAACAGGG + Intergenic
1146796462 17:35784725-35784747 ATGGAAGCCTAGAAGGAAAATGG - Intronic
1148382318 17:47209100-47209122 GTGGAAACCCAGAAGGACCAGGG - Exonic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149395927 17:56243664-56243686 ATGGAAGCCCAGGTGGCTAAGGG + Intronic
1152473806 17:80504454-80504476 ATGGATGCACAGAGGGAAAAAGG + Intergenic
1153756812 18:8292373-8292395 ATGGGAGCCCAGAGAGAAAAGGG - Intronic
1156173133 18:34510480-34510502 ATGGAATGACTGATGGAACAGGG - Intronic
1156594064 18:38525755-38525777 ATGGAAGGCTAGAGGGAACTGGG - Intergenic
1158275798 18:55766035-55766057 ATAGAAGCTCAGATGGAAGGGGG + Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159377439 18:67611527-67611549 AAAGAAGCCCAGATGGCACATGG + Intergenic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161034948 19:2079373-2079395 ATGGCAGCCTAGGTGGAAGAAGG + Intronic
1161456599 19:4372798-4372820 CTGGGAGCCCACATGGAAAAGGG - Intronic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1162496885 19:11028381-11028403 AAGGAAGCCAAGATGGAAGAAGG - Intronic
1167652459 19:50740186-50740208 ATTGAAGACCAGCTGAAACAGGG + Intergenic
1168573116 19:57487037-57487059 ATGGAAGAGCAGTGGGAACATGG + Intergenic
925375123 2:3378674-3378696 CTGGAAGCCCCGGTGGAACCAGG - Intergenic
926621557 2:15050749-15050771 GTGGAAACCCAGATGGAACCCGG - Intergenic
931239198 2:60437585-60437607 AGTCAAGCCCAGATGGAGCAAGG + Intergenic
932550753 2:72766990-72767012 ATTGAAGCCCAAAGAGAACAAGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933989352 2:87622655-87622677 ATGCAAGGCAAGAGGGAACATGG - Intergenic
936304490 2:111328171-111328193 ATGCAAGGCAAGAGGGAACATGG + Intergenic
940155044 2:150646998-150647020 ATAGAATGCCAGATGGAGCATGG - Intergenic
941983246 2:171483354-171483376 ATGCAAGCCCAGGTGAAGCAGGG + Exonic
944203333 2:197131819-197131841 ATGGAAGCCCACTTGGTAGAAGG - Intronic
946178513 2:217936466-217936488 AAGGAAGCCCAGAGGGATCAGGG + Intronic
947376513 2:229502157-229502179 AAGGAAACCCATATGGAGCATGG + Intronic
949006290 2:241650537-241650559 AGGGAAGCCAAGAAGAAACAGGG - Intronic
1170300903 20:14883488-14883510 GGGGAAGCCCAGAGGGAAAAAGG - Intronic
1170551468 20:17480918-17480940 GAGGAAGCCCAGGGGGAACACGG + Intronic
1171413690 20:24963340-24963362 ATGGAAGAGCAGAGGGAGCATGG - Exonic
1174497120 20:50955231-50955253 ATGGAAGCCCAGATGGAACAAGG - Exonic
1174499236 20:50972123-50972145 ATGTAAATCCAGTTGGAACAGGG + Intergenic
1176415167 21:6470406-6470428 ATGGAATGCCAAATGGTACATGG - Intergenic
1176736343 21:10550404-10550426 ATGGAAGCCCAAAGTGAGCAGGG + Intronic
1176985437 21:15431018-15431040 ATGGATGCCCAGGTGGGACTGGG - Intergenic
1178579678 21:33827887-33827909 ATGTAAGCCCAGTTGGAGCTGGG - Intronic
1179228309 21:39476228-39476250 ATGGAAGCCCAGGAGGAGCTTGG + Intronic
1179436515 21:41366028-41366050 AGGGAAGCCCAAATGGAGAAAGG - Intronic
1179690667 21:43078739-43078761 ATGGAATGCCAAATGGTACATGG - Intergenic
1180103195 21:45599508-45599530 ATGGCAGCCCAGAGGGAACAAGG - Intergenic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1181949879 22:26546248-26546270 ATCTAAACCCAGATGGAAAAGGG + Intronic
1182464730 22:30507325-30507347 ATGGGAGGACAGAGGGAACAGGG - Intergenic
1182484300 22:30630111-30630133 ATGGGAGCCCAGAGGGGCCAGGG - Intergenic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1183212338 22:36458622-36458644 ATGGAAGCCCAGAGAGGGCAGGG - Intergenic
1183343941 22:37296546-37296568 ATGGAAGCCCAGCTGCCACCTGG - Intronic
1183903630 22:41023630-41023652 AAGGCAGCTCAGATGTAACATGG - Intergenic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
949242500 3:1889260-1889282 AGGAAAGCCCAGAGGGAAAATGG + Intergenic
949491358 3:4592610-4592632 AGGGAAGCAAAGATGAAACATGG - Intronic
950708935 3:14801678-14801700 AGGGACACCCAGAAGGAACAGGG + Intergenic
952955501 3:38554779-38554801 ATGGAAGGCCTCATGGAAGATGG - Intronic
953049123 3:39324560-39324582 GTGGTAGCCCAGTTGGGACAAGG + Intergenic
953747630 3:45587168-45587190 ATGGAAGTCCAAATAGGACAGGG + Intronic
954183444 3:48899080-48899102 ATGGGAGCTCAGAGGAAACATGG - Intergenic
954608525 3:51932009-51932031 AAGGAAGCCCCGACGGAGCAAGG + Intergenic
957383193 3:79461246-79461268 AGGCAAGCCCAGATGCAACAGGG - Intronic
957383283 3:79462248-79462270 AGGCAAGCCCAGATGCAACGGGG + Intronic
960956955 3:123039368-123039390 ATGGAAGCCGAGATTGTCCATGG + Intergenic
962573639 3:136736017-136736039 TTGAAGGCCCAGATGAAACAGGG - Intronic
963179754 3:142341742-142341764 ATGGAAACCAAAATGGAGCAGGG + Intronic
963398411 3:144763811-144763833 TTGTATGCCCAGATGGAATATGG - Intergenic
964525519 3:157612357-157612379 ATGGCATCCCAGAGGGAAAAAGG + Intronic
967723238 3:192837415-192837437 TGGGAAGCCCAGGTGGGACAGGG - Intronic
968120600 3:196123169-196123191 AGGGAAGCCCAGGGGGAAGAAGG - Intergenic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
981649281 4:147037726-147037748 ATGGATGTGCAGATGAAACAGGG + Intergenic
986040311 5:3987892-3987914 ATGGAAGGGCAGATGGAAGAAGG + Intergenic
986156819 5:5184402-5184424 ATCGATGCACAGATGGCACAGGG - Intronic
986861109 5:11927658-11927680 ATGGAAGCCCAGGAGCACCAGGG + Intergenic
988433064 5:31142230-31142252 ATGGAGGCCCTGATGGATAAAGG - Intergenic
989246820 5:39264448-39264470 ATGGCAGCCCAAATGGACTAAGG + Intronic
992174873 5:74139899-74139921 ATGGGAGCTCAGAAGGAGCAGGG + Intergenic
994178694 5:96740459-96740481 ATAGAAGCACAGAAGGAAGACGG - Intronic
995922129 5:117327174-117327196 ATGTGAGCCCAGATGGTAAAGGG - Intergenic
996224515 5:120974948-120974970 ATTCAAGCCCAGATTGTACAAGG - Intergenic
998212587 5:140211558-140211580 ATGGAAGGCCACATGATACATGG - Intronic
998401918 5:141852738-141852760 AGGGAAGCCCAACTGGAAGAAGG + Intergenic
998402109 5:141853426-141853448 ATGGGGGCCCAGATGGGACTAGG + Exonic
998848906 5:146336362-146336384 CTGGAAGCCCAAAGGGAAAAGGG - Intronic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
999503643 5:152172229-152172251 ATGGAAGCCCAGTTGCTGCACGG + Intergenic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1001976536 5:176004565-176004587 ATGTAACCGGAGATGGAACATGG - Intronic
1002593387 5:180306330-180306352 ATGGCAGCCCAGCTGGGCCACGG + Intronic
1002604645 5:180375417-180375439 ATGGAAGCTTTGAAGGAACATGG - Intergenic
1002860296 6:1074148-1074170 ATGGCAGCCCACATGGACTAAGG + Intergenic
1003035627 6:2638410-2638432 ATTGAGGCCCAGCAGGAACATGG - Intergenic
1007667641 6:43524846-43524868 CTGGAAGGCCAGATGGACCAGGG + Exonic
1008556053 6:52673586-52673608 AAGGATGCCCAGATCAAACAGGG - Intronic
1012307545 6:97677182-97677204 AAGGAAGCCCAGAGGAAAGAGGG - Intergenic
1012714239 6:102648621-102648643 TTGGAAGAGAAGATGGAACAGGG + Intergenic
1012882903 6:104813058-104813080 CTGGGAGCCTAGTTGGAACATGG - Intronic
1013964118 6:115935189-115935211 ATGGAGGGCCAGCTGAAACAGGG + Exonic
1014028691 6:116677465-116677487 ATGGCAGCCCAAATGGAATAAGG - Intergenic
1014578937 6:123110110-123110132 ATGGAAGCCCACTTTGAATAAGG + Intergenic
1015855168 6:137616548-137616570 AAGGAAGCCCAGATGAAAGCTGG - Intergenic
1017154058 6:151307408-151307430 ATGAAAGCCCAGAAGGGAAAAGG + Intronic
1018766788 6:166939987-166940009 ATGGAAGCCCAGAAGGGCCAGGG + Intronic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1024042577 7:45566779-45566801 ATCGAAAGCCAGATAGAACATGG + Intergenic
1024199982 7:47096779-47096801 AAGGAAGCCCAGGGGGCACAAGG - Intergenic
1024255990 7:47540373-47540395 TTGGAAACCCAGCTGGAACTAGG + Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1029974150 7:104816893-104816915 ATGGAAACCCAGAAGACACAAGG - Intronic
1030907812 7:115207916-115207938 GTGGAAGCGGAGAAGGAACAAGG + Intergenic
1032774046 7:135091187-135091209 AGGGAAGGCCATATGGAAAATGG - Intronic
1032787625 7:135213038-135213060 ATGGATGCCCTGATGTAAAAAGG - Intergenic
1034306763 7:150049493-150049515 ATGGAAACCCGGAAGGAGCAGGG - Intergenic
1034388805 7:150765914-150765936 ATGGAAGCCCAACTGCAACACGG - Intergenic
1034447790 7:151122317-151122339 AAGCAAGGCCAGAGGGAACAAGG - Intronic
1034800081 7:154051149-154051171 ATGGAAACCCGGAAGGAGCAGGG + Intronic
1034844380 7:154430832-154430854 ATGGAAGCTCAGCTGGCACATGG + Intronic
1035654646 8:1296268-1296290 AAAGAACCCAAGATGGAACAAGG - Intergenic
1037104326 8:15086507-15086529 GTGGAAGAGAAGATGGAACAAGG - Intronic
1038360907 8:26875770-26875792 ATGGAAGCCAAAAGAGAACAGGG - Intergenic
1039369555 8:36970956-36970978 AGGGAATCCCAGGTGCAACAGGG + Intergenic
1044051064 8:87504902-87504924 ATGTAAGTCCATATGGAAAAAGG + Intronic
1044218765 8:89645489-89645511 ATGGAAGCCCAGAGTGATGAAGG - Intergenic
1044921003 8:97169477-97169499 ATGGCAGCACAGATGGACTAAGG - Intergenic
1044952134 8:97445100-97445122 AAGAAAGCCCTCATGGAACATGG - Intergenic
1047129966 8:122008124-122008146 ATTGAACCCCAGATGTCACAGGG - Intergenic
1048577399 8:135703961-135703983 ACGGAAGCTCAGATGCACCAGGG + Intergenic
1048600043 8:135910137-135910159 AGGTAAGGCCAGATGGACCAGGG - Intergenic
1049941577 9:551038-551060 AGGAAAGCCAAGATGGAAAATGG + Intronic
1050110619 9:2211650-2211672 ATGGAAGCCCAATTACAACAGGG - Intergenic
1050507697 9:6364619-6364641 AGGGATGCCCAGAGAGAACACGG - Intergenic
1050623745 9:7481667-7481689 ATAAAAGCCCACATGGAAGATGG - Intergenic
1050819259 9:9856784-9856806 ATGGATGCCCCCATGGAAAATGG + Intronic
1051403872 9:16713181-16713203 ATGGAAACCCAAATGGAAATGGG + Intronic
1052443588 9:28530293-28530315 ATGGAATGGCAGATGGCACATGG - Intronic
1053476330 9:38384548-38384570 AAGGAAGCCCAGAGGGAAGCAGG - Intergenic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1056920643 9:90785403-90785425 AGGGCAGCCCAGATGCAAGAGGG + Intergenic
1058747577 9:108006991-108007013 ACAGAACCCCAGATGGAAAAGGG + Intergenic
1058980994 9:110170552-110170574 ATGGCAGCCCAAATAGCACATGG + Exonic
1059676122 9:116541653-116541675 ATGGAAGCAGAGACAGAACAAGG + Intronic
1059751412 9:117250951-117250973 AGGGAAGAGCAGGTGGAACAAGG + Intronic
1060776478 9:126378430-126378452 AAGGCAGCCCTGGTGGAACAAGG - Intronic
1061264973 9:129499590-129499612 ATGGAAGCAAAGAGGGAAAAAGG + Intergenic
1061549490 9:131325163-131325185 AAGGAAGGGGAGATGGAACAAGG - Intergenic
1061779463 9:132987217-132987239 TGGGAAGCCCAGAGGGAGCAAGG - Intronic
1062369729 9:136231744-136231766 ATGGAAGCTCAAAAGGAATAAGG - Intronic
1062453989 9:136627185-136627207 CAGGAAGCCCAGCTGGAGCACGG + Intergenic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190570662 X:51778549-51778571 ATGGAACACCAGATTAAACAGGG + Intergenic
1192053106 X:67745256-67745278 AAGGAAGCCCAAATGGAAAACGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200274998 X:154723679-154723701 TGGGAAGCCAAGATGGAAAAGGG + Intronic
1201949724 Y:19550421-19550443 TTGGAAGACCAGTTGGAGCAGGG - Intergenic