ID: 1174503562

View in Genome Browser
Species Human (GRCh38)
Location 20:51002762-51002784
Sequence CAGTGCCAGGCGTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174503562_1174503577 22 Left 1174503562 20:51002762-51002784 CCCCCTCCCCACGCCTGGCACTG No data
Right 1174503577 20:51002807-51002829 TGGAGTAGAATCTGCTGGACTGG No data
1174503562_1174503573 2 Left 1174503562 20:51002762-51002784 CCCCCTCCCCACGCCTGGCACTG No data
Right 1174503573 20:51002787-51002809 GGGCTCTATGTCCTGCCAGCTGG No data
1174503562_1174503576 17 Left 1174503562 20:51002762-51002784 CCCCCTCCCCACGCCTGGCACTG No data
Right 1174503576 20:51002802-51002824 CCAGCTGGAGTAGAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174503562 Original CRISPR CAGTGCCAGGCGTGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr