ID: 1174507002

View in Genome Browser
Species Human (GRCh38)
Location 20:51023294-51023316
Sequence GGCCCCCGGATCCAAGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174507002_1174507011 9 Left 1174507002 20:51023294-51023316 CCCGCACCTTGGATCCGGGGGCC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1174507011 20:51023326-51023348 CTGCTGGATTGCGCTCCTCGCGG 0: 1
1: 0
2: 1
3: 1
4: 54
1174507002_1174507007 -7 Left 1174507002 20:51023294-51023316 CCCGCACCTTGGATCCGGGGGCC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1174507007 20:51023310-51023332 GGGGGCCCTGGCGCGCCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174507002 Original CRISPR GGCCCCCGGATCCAAGGTGC GGG (reversed) Intergenic
903266400 1:22160554-22160576 GGCCCCCGCACCCACGGAGCTGG - Intergenic
904945536 1:34196317-34196339 GGACCCAGGGTCCAAGGGGCAGG + Intronic
907369756 1:53993074-53993096 GGCCTCCGGCTCCATGTTGCTGG - Intergenic
912391611 1:109306943-109306965 GGCCGCAGGATCCAAGCTGAAGG - Exonic
915517934 1:156423958-156423980 GGCCCCAGCCTCCCAGGTGCTGG - Intronic
916936511 1:169633420-169633442 GGCTCCAGGATCCAGGGTGTGGG - Intergenic
924035210 1:239929575-239929597 GATCCCTGGATCAAAGGTGCCGG - Intergenic
1063607860 10:7538845-7538867 GGCCTCAGAATCCACGGTGCAGG + Intergenic
1067066672 10:43107715-43107737 GGTCCCCAGGTCCAAGGTGGTGG + Intronic
1068638762 10:59378156-59378178 GGCCCTCAGATGCTAGGTGCAGG + Intergenic
1068967177 10:62924470-62924492 GGCCTCCGGCTCCACGGAGCAGG - Intergenic
1069717675 10:70531397-70531419 GGACCCCGGGTCCAAGGCCCTGG - Exonic
1076767331 10:132643801-132643823 GGCGCCAGGACCCAAGGTGATGG - Intronic
1078583798 11:12562228-12562250 GGCCCCTGAATCCAATCTGCTGG + Intergenic
1079098018 11:17523336-17523358 GGCCCCAGGCTCCAGGGTGGTGG + Intronic
1080690030 11:34548796-34548818 GACTCCCGGATCCAAGGTTGGGG - Intergenic
1081867298 11:46366838-46366860 GGCCCCCAGGGCCAGGGTGCTGG - Exonic
1082005279 11:47415727-47415749 AGCCCAAGGATCCAGGGTGCAGG + Exonic
1082879197 11:58021767-58021789 GGCCACCAGTTCCAAGGTTCTGG + Intergenic
1083448410 11:62726643-62726665 GACGCCGGGATCCGAGGTGCCGG - Exonic
1083600275 11:63943016-63943038 GGCTCAGGGATCAAAGGTGCTGG - Intronic
1083996739 11:66276687-66276709 GGGCCCTGGATCCCAGGTCCTGG - Exonic
1084429590 11:69103687-69103709 GACCCCCAGATGCAGGGTGCTGG + Intergenic
1085053379 11:73390963-73390985 GGCCCCAGGATCCAGAGTCCTGG - Intronic
1087432374 11:98070035-98070057 GACCCTCGGATTCAAGCTGCTGG - Intergenic
1088021572 11:105125788-105125810 GTCCCCTGGGTCCAAGCTGCTGG + Intergenic
1089823064 11:121246270-121246292 GGCCTCCCGCTCCAAGGAGCAGG + Intergenic
1097107483 12:56634307-56634329 GGCCCCCAGCTCCCAGGTTCTGG + Intronic
1099423079 12:82488318-82488340 GGCCCCCTGACCCAAGTAGCTGG + Intergenic
1100565489 12:95790459-95790481 GGCCCCTGGCTCCCAGCTGCCGG - Exonic
1103883650 12:124185417-124185439 GCCCCACCGAGCCAAGGTGCTGG + Intronic
1104432537 12:128728211-128728233 GGCCACTGGATCCAGGCTGCTGG - Intergenic
1106187845 13:27424730-27424752 GGCCGGCGGATCCAGGGCGCCGG - Exonic
1106252429 13:27992454-27992476 GCCCCCCAGCCCCAAGGTGCAGG - Intergenic
1110195583 13:72784507-72784529 GGCCTCAGCATCCAAAGTGCTGG - Intronic
1112602144 13:100867821-100867843 GGCCCTGGGATCCAAGACGCAGG + Intergenic
1113485013 13:110646938-110646960 GGCCCCAGGAGACAGGGTGCTGG - Intronic
1113647600 13:112010177-112010199 GGCCACCGGATCCAGGATGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1118213670 14:63788380-63788402 GGCCTCCTGCTCCAAGGAGCCGG - Intergenic
1118318628 14:64740676-64740698 GGCCCCAGGTTCCCAGGGGCTGG - Intronic
1119851195 14:77867761-77867783 GACACCAGGATTCAAGGTGCAGG - Intronic
1122549207 14:102540624-102540646 AGCCCCGGGAACCAAGCTGCAGG - Intergenic
1122797430 14:104212962-104212984 GGCCCTGGGAGCCTAGGTGCCGG - Intergenic
1128329117 15:66744436-66744458 GGCCACCGGATCCCAAGTCCAGG + Intronic
1128788523 15:70415723-70415745 GGCTCCAGCAGCCAAGGTGCTGG - Intergenic
1132684164 16:1155337-1155359 GTCCCCGGGAGCCGAGGTGCAGG + Intronic
1132862175 16:2077109-2077131 GGCCCCCGGCCCCCAGGGGCTGG - Intronic
1132949271 16:2551437-2551459 GGCCCCCGGACCAAAGTTGTGGG - Intronic
1132965317 16:2650691-2650713 GGCCCCCGGACCAAAGTTGTGGG + Intergenic
1133262657 16:4561472-4561494 GATACCAGGATCCAAGGTGCCGG + Intronic
1136341746 16:29648519-29648541 GGCCCCCGGGTCAGAGGCGCCGG + Intergenic
1138519404 16:57562488-57562510 GACCCACTGATTCAAGGTGCAGG - Intronic
1141478746 16:84292275-84292297 GGCCCCAGGTTCCAAGCAGCAGG + Intergenic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1147685557 17:42284804-42284826 GGCACCAGGATCCAAGTTGCCGG - Intergenic
1157858327 18:51120989-51121011 CGCCCCCTGCTCCAAGGCGCCGG - Intergenic
1161223832 19:3133128-3133150 GGGCCCTGGATCCAGGGAGCCGG + Intergenic
1162741401 19:12775662-12775684 GGTGCCCGGATCCAAGATGGCGG - Intronic
1162760478 19:12885737-12885759 GGCCCCCGAGCCCAAGGCGCTGG - Exonic
1162916271 19:13876082-13876104 GGCCCCCTGAGGCTAGGTGCTGG - Intronic
1163473634 19:17512240-17512262 GGCCCCCGTAGTCGAGGTGCAGG - Intronic
1163567090 19:18058343-18058365 GGCCCCCAGACCAAAGGGGCGGG + Intergenic
1165333456 19:35154142-35154164 GACTCCCGGATCCCAGGAGCTGG - Exonic
1165596111 19:37012224-37012246 GGCACCTGGATCCAAGGTCGAGG - Intronic
1166156118 19:40912501-40912523 GGGCCCTGGATCCAGGGAGCTGG + Intergenic
1166412250 19:42563551-42563573 GGCCCACGGTTAGAAGGTGCTGG - Intergenic
1167095928 19:47375169-47375191 GCCCCCCAGACCCAAGGGGCAGG + Intronic
925129973 2:1487932-1487954 GGACGCCAGATCCAAGGTGCTGG - Exonic
927159218 2:20242386-20242408 GGCCCCCGGACCCGCGGCGCAGG + Intergenic
931517139 2:63056511-63056533 GGTCCCCCCATCCAAGGGGCAGG - Exonic
932174302 2:69585492-69585514 GGCCCCTGGTTCCAATGGGCTGG + Intronic
943639642 2:190344015-190344037 GGGCCCCAGATCCAAGGAGGAGG - Intronic
944222102 2:197312585-197312607 GGCCCCAGGAACTTAGGTGCAGG - Intergenic
948453744 2:238094507-238094529 GGACCCCGGCTTCAAGGTGATGG + Exonic
948939653 2:241189495-241189517 GACCCCCGGGGCGAAGGTGCGGG + Intronic
1173514769 20:43657562-43657584 GGCCGCCTGATCCCAGGCGCGGG + Intergenic
1174082576 20:47981023-47981045 GGCCCCTGTTTCCAAGGGGCAGG + Intergenic
1174507002 20:51023294-51023316 GGCCCCCGGATCCAAGGTGCGGG - Intergenic
1175368478 20:58471162-58471184 GGACTCAGGACCCAAGGTGCTGG + Intronic
1175981180 20:62739447-62739469 GGCCCCCTGAGCCCAGGGGCTGG + Intronic
1183692745 22:39400026-39400048 GGCCCCCGGGTCAAGGGCGCCGG + Intronic
1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG + Intronic
1184778865 22:46636243-46636265 GGCCAGCGGAGCCCAGGTGCTGG - Intronic
1185268835 22:49918989-49919011 GGACCCCGGATCCAGGGTGAGGG - Intronic
949877417 3:8635320-8635342 GGCCCCAGGAGCAAAGGTCCTGG - Exonic
950645986 3:14377052-14377074 GGCACCCAGATCCCAGATGCAGG - Intergenic
951136342 3:19107817-19107839 GGCCTCCTGCTCCAAGGAGCAGG - Intergenic
955060422 3:55488117-55488139 GGCGCCCGGGTCCGAGGGGCGGG + Intronic
956990106 3:74752348-74752370 GGCCCCTGGATCCACGGAGCAGG - Intergenic
960574641 3:119218012-119218034 GGCCCCCAAATCCAAGTTGAGGG + Intronic
961778350 3:129306039-129306061 GGCCCCCGCCTCCACAGTGCAGG - Exonic
962265745 3:133943066-133943088 GGCCCCTGGCTCCAAGCTGGGGG - Intronic
964255123 3:154766843-154766865 GGCCTCCTGATCCAGGGTGCAGG - Intergenic
966246027 3:177808974-177808996 CGCCCCCTGCTCCACGGTGCCGG - Intergenic
966883664 3:184362948-184362970 GGCCCCGGGGTCCTCGGTGCCGG + Intronic
968619825 4:1599068-1599090 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619846 4:1599134-1599156 GGCCAGGGGATCCAGGGTGCTGG + Intergenic
968619868 4:1599200-1599222 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619887 4:1599266-1599288 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
976734587 4:88296829-88296851 GGCCTCCTGTTCCAAGGAGCAGG - Intergenic
977134843 4:93291120-93291142 GCCCACCAGATCCAAAGTGCTGG + Intronic
985145162 4:186889054-186889076 GGCCCCGGGGCCCACGGTGCTGG + Intergenic
986724120 5:10581439-10581461 GGCTCCCGGATCCAGGGTAGAGG - Intronic
988536104 5:32070702-32070724 GGCGCCCGGCTCCATGGAGCTGG - Intronic
1000300295 5:159950604-159950626 GGCCCCAGCATCAAAGGTGGAGG + Intronic
1001984232 5:176060654-176060676 GGCCCCGGGATCCGCGCTGCTGG - Intronic
1002081697 5:176741270-176741292 GGACCCCAGATCCTAGCTGCGGG - Intergenic
1002233243 5:177783411-177783433 GGCCCCGGGATCCGCGCTGCTGG + Intronic
1002262735 5:178006370-178006392 GGCCCCGGGATCCGCGCTGCTGG - Intergenic
1002347099 5:178555751-178555773 GTTCCCAGGCTCCAAGGTGCCGG + Intronic
1003276235 6:4655669-4655691 GGGCACCAGCTCCAAGGTGCAGG + Intergenic
1015838054 6:137444021-137444043 GGCCCCAGGGTCCCATGTGCTGG + Intergenic
1019344680 7:523430-523452 GATCCCCAGTTCCAAGGTGCAGG + Intergenic
1019409703 7:901165-901187 GGCCCTCTGTTCCAGGGTGCTGG - Intronic
1019551031 7:1602610-1602632 TGCCCCCGGAGCCCAGGTGCGGG - Intergenic
1019625346 7:2013084-2013106 GGCCCCTGGAGCCGAGCTGCTGG - Intronic
1019663883 7:2241876-2241898 GGGGCCCAGATCCAAGGCGCCGG - Intronic
1019701259 7:2475951-2475973 GGCCCCCGGCTGGAAGCTGCTGG - Exonic
1019733151 7:2638390-2638412 GTCCCCCGGCTACAGGGTGCAGG + Intronic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1026474005 7:70718412-70718434 CGCCCCAGGCTCCAAAGTGCTGG - Intronic
1026960471 7:74404445-74404467 GGCCCCCAGGTTCAAGGTGTTGG + Exonic
1034481076 7:151320842-151320864 AGCCCCAGGATTCAAGGAGCTGG + Intergenic
1034983230 7:155491432-155491454 GGCTCCCGGGACCAGGGTGCAGG + Intronic
1035452860 7:158989665-158989687 GCACCCCGCCTCCAAGGTGCTGG - Intergenic
1040038906 8:42897007-42897029 GGCGGCCGGATCCGAGGAGCAGG + Exonic
1049179928 8:141216994-141217016 GGCCCCAGCTTCTAAGGTGCAGG + Intronic
1049618124 8:143585213-143585235 GCCCCCAGGATCCCAGGTCCAGG - Intronic
1053351777 9:37418017-37418039 GGCCCCCGGAACCGAGGGGCAGG - Intergenic
1056666584 9:88585901-88585923 GACCTCCGGAGGCAAGGTGCAGG - Intergenic
1062023033 9:134327999-134328021 GCCCCCAGGATACAAGGTGGTGG + Intronic
1062554575 9:137108141-137108163 GGCCCCCTGAGCCCAGGTTCTGG + Intronic
1193731253 X:85106742-85106764 GCCCCCAGGAGCCAAGGAGCTGG - Intronic
1195092901 X:101480264-101480286 GGCTCCAGAATCCAAAGTGCTGG + Intronic