ID: 1174508027

View in Genome Browser
Species Human (GRCh38)
Location 20:51029511-51029533
Sequence CTTTCCTGCCTGGCAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174508022_1174508027 15 Left 1174508022 20:51029473-51029495 CCCTTGAAAACTTAGAAGATGTG No data
Right 1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG No data
1174508023_1174508027 14 Left 1174508023 20:51029474-51029496 CCTTGAAAACTTAGAAGATGTGC No data
Right 1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG No data
1174508021_1174508027 30 Left 1174508021 20:51029458-51029480 CCAGATTTCTGGCTTCCCTTGAA No data
Right 1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG No data
1174508024_1174508027 -8 Left 1174508024 20:51029496-51029518 CCAATTCTGAACCTGCTTTCCTG No data
Right 1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174508027 Original CRISPR CTTTCCTGCCTGGCAAAAAT TGG Intergenic
No off target data available for this crispr