ID: 1174510084

View in Genome Browser
Species Human (GRCh38)
Location 20:51044760-51044782
Sequence AAGACCCTGTCTAAAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174510084_1174510086 -8 Left 1174510084 20:51044760-51044782 CCTCCTGTTTTAGACAGGGTCTT No data
Right 1174510086 20:51044775-51044797 AGGGTCTTGCTCTGTCACCCAGG 0: 4209
1: 20933
2: 63781
3: 122612
4: 173503
1174510084_1174510087 6 Left 1174510084 20:51044760-51044782 CCTCCTGTTTTAGACAGGGTCTT No data
Right 1174510087 20:51044789-51044811 TCACCCAGGCTGAAGTGCAGTGG 0: 2747
1: 89943
2: 178750
3: 206710
4: 176534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174510084 Original CRISPR AAGACCCTGTCTAAAACAGG AGG (reversed) Intergenic
No off target data available for this crispr