ID: 1174516955

View in Genome Browser
Species Human (GRCh38)
Location 20:51100039-51100061
Sequence GCTTCCTATTGGAATGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174516955_1174516965 20 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516965 20:51100082-51100104 CCAGGGCTTCCAGGTTCTCTGGG No data
1174516955_1174516962 11 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516962 20:51100073-51100095 GCTTTGTCTCCAGGGCTTCCAGG No data
1174516955_1174516960 2 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516960 20:51100064-51100086 GCAGCTGAAGCTTTGTCTCCAGG No data
1174516955_1174516961 3 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516961 20:51100065-51100087 CAGCTGAAGCTTTGTCTCCAGGG No data
1174516955_1174516963 19 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data
1174516955_1174516966 21 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516966 20:51100083-51100105 CAGGGCTTCCAGGTTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174516955 Original CRISPR GCTTCCTATTGGAATGTACA GGG (reversed) Intergenic