ID: 1174516958

View in Genome Browser
Species Human (GRCh38)
Location 20:51100050-51100072
Sequence TTCAGCTGCCGGCTTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174516958_1174516963 8 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data
1174516958_1174516961 -8 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516961 20:51100065-51100087 CAGCTGAAGCTTTGTCTCCAGGG No data
1174516958_1174516966 10 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516966 20:51100083-51100105 CAGGGCTTCCAGGTTCTCTGGGG No data
1174516958_1174516965 9 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516965 20:51100082-51100104 CCAGGGCTTCCAGGTTCTCTGGG No data
1174516958_1174516962 0 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516962 20:51100073-51100095 GCTTTGTCTCCAGGGCTTCCAGG No data
1174516958_1174516960 -9 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516960 20:51100064-51100086 GCAGCTGAAGCTTTGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174516958 Original CRISPR TTCAGCTGCCGGCTTCCTAT TGG (reversed) Intergenic