ID: 1174516959

View in Genome Browser
Species Human (GRCh38)
Location 20:51100061-51100083
Sequence GGAGACAAAGCTTCAGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174516959_1174516965 -2 Left 1174516959 20:51100061-51100083 CCGGCAGCTGAAGCTTTGTCTCC No data
Right 1174516965 20:51100082-51100104 CCAGGGCTTCCAGGTTCTCTGGG No data
1174516959_1174516968 20 Left 1174516959 20:51100061-51100083 CCGGCAGCTGAAGCTTTGTCTCC No data
Right 1174516968 20:51100104-51100126 GGTTTCTTCCTTTCTGACCCTGG No data
1174516959_1174516966 -1 Left 1174516959 20:51100061-51100083 CCGGCAGCTGAAGCTTTGTCTCC No data
Right 1174516966 20:51100083-51100105 CAGGGCTTCCAGGTTCTCTGGGG No data
1174516959_1174516970 30 Left 1174516959 20:51100061-51100083 CCGGCAGCTGAAGCTTTGTCTCC No data
Right 1174516970 20:51100114-51100136 TTTCTGACCCTGGAAACAGAAGG No data
1174516959_1174516963 -3 Left 1174516959 20:51100061-51100083 CCGGCAGCTGAAGCTTTGTCTCC No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174516959 Original CRISPR GGAGACAAAGCTTCAGCTGC CGG (reversed) Intergenic