ID: 1174516962

View in Genome Browser
Species Human (GRCh38)
Location 20:51100073-51100095
Sequence GCTTTGTCTCCAGGGCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174516955_1174516962 11 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516962 20:51100073-51100095 GCTTTGTCTCCAGGGCTTCCAGG No data
1174516958_1174516962 0 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516962 20:51100073-51100095 GCTTTGTCTCCAGGGCTTCCAGG No data
1174516953_1174516962 15 Left 1174516953 20:51100035-51100057 CCAACCCTGTACATTCCAATAGG No data
Right 1174516962 20:51100073-51100095 GCTTTGTCTCCAGGGCTTCCAGG No data
1174516956_1174516962 10 Left 1174516956 20:51100040-51100062 CCTGTACATTCCAATAGGAAGCC No data
Right 1174516962 20:51100073-51100095 GCTTTGTCTCCAGGGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174516962 Original CRISPR GCTTTGTCTCCAGGGCTTCC AGG Intergenic