ID: 1174516963

View in Genome Browser
Species Human (GRCh38)
Location 20:51100081-51100103
Sequence TCCAGGGCTTCCAGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174516959_1174516963 -3 Left 1174516959 20:51100061-51100083 CCGGCAGCTGAAGCTTTGTCTCC No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data
1174516953_1174516963 23 Left 1174516953 20:51100035-51100057 CCAACCCTGTACATTCCAATAGG No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data
1174516956_1174516963 18 Left 1174516956 20:51100040-51100062 CCTGTACATTCCAATAGGAAGCC No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data
1174516958_1174516963 8 Left 1174516958 20:51100050-51100072 CCAATAGGAAGCCGGCAGCTGAA No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data
1174516955_1174516963 19 Left 1174516955 20:51100039-51100061 CCCTGTACATTCCAATAGGAAGC No data
Right 1174516963 20:51100081-51100103 TCCAGGGCTTCCAGGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174516963 Original CRISPR TCCAGGGCTTCCAGGTTCTC TGG Intergenic