ID: 1174520495

View in Genome Browser
Species Human (GRCh38)
Location 20:51126415-51126437
Sequence TCCAGGACGTTGCTTGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174520495_1174520501 6 Left 1174520495 20:51126415-51126437 CCAAATACAAGCAACGTCCTGGA No data
Right 1174520501 20:51126444-51126466 GGCGCTTACAGGCAGAGGCGAGG No data
1174520495_1174520499 -5 Left 1174520495 20:51126415-51126437 CCAAATACAAGCAACGTCCTGGA No data
Right 1174520499 20:51126433-51126455 CTGGAGAGAAGGGCGCTTACAGG No data
1174520495_1174520500 1 Left 1174520495 20:51126415-51126437 CCAAATACAAGCAACGTCCTGGA No data
Right 1174520500 20:51126439-51126461 AGAAGGGCGCTTACAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174520495 Original CRISPR TCCAGGACGTTGCTTGTATT TGG (reversed) Intergenic
No off target data available for this crispr