ID: 1174522440

View in Genome Browser
Species Human (GRCh38)
Location 20:51142075-51142097
Sequence CAGTTCATCTGGGACCGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174522431_1174522440 26 Left 1174522431 20:51142026-51142048 CCACTATGTTTATCGGGGCCAGG No data
Right 1174522440 20:51142075-51142097 CAGTTCATCTGGGACCGAGAGGG No data
1174522434_1174522440 8 Left 1174522434 20:51142044-51142066 CCAGGTTGGCATCCAAGATAACT No data
Right 1174522440 20:51142075-51142097 CAGTTCATCTGGGACCGAGAGGG No data
1174522435_1174522440 -4 Left 1174522435 20:51142056-51142078 CCAAGATAACTGACCGTCTCAGT No data
Right 1174522440 20:51142075-51142097 CAGTTCATCTGGGACCGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174522440 Original CRISPR CAGTTCATCTGGGACCGAGA GGG Intergenic
No off target data available for this crispr