ID: 1174528877

View in Genome Browser
Species Human (GRCh38)
Location 20:51195272-51195294
Sequence CTTCCTCTCCTTCATAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174528873_1174528877 -3 Left 1174528873 20:51195252-51195274 CCAGGAACGTGCCATGTGCCCTT No data
Right 1174528877 20:51195272-51195294 CTTCCTCTCCTTCATAGAGCTGG No data
1174528870_1174528877 17 Left 1174528870 20:51195232-51195254 CCAGTGTACCGTGTGCACATCCA No data
Right 1174528877 20:51195272-51195294 CTTCCTCTCCTTCATAGAGCTGG No data
1174528872_1174528877 9 Left 1174528872 20:51195240-51195262 CCGTGTGCACATCCAGGAACGTG No data
Right 1174528877 20:51195272-51195294 CTTCCTCTCCTTCATAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174528877 Original CRISPR CTTCCTCTCCTTCATAGAGC TGG Intergenic
No off target data available for this crispr