ID: 1174531231

View in Genome Browser
Species Human (GRCh38)
Location 20:51215981-51216003
Sequence TTGAAATCTTACAATGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174531231_1174531234 3 Left 1174531231 20:51215981-51216003 CCCGCAACATTGTAAGATTTCAA No data
Right 1174531234 20:51216007-51216029 GGAAAAGAAATCTTTTATTTTGG No data
1174531231_1174531238 20 Left 1174531231 20:51215981-51216003 CCCGCAACATTGTAAGATTTCAA No data
Right 1174531238 20:51216024-51216046 TTTTGGGGCCTCAAAGGTCTAGG No data
1174531231_1174531236 5 Left 1174531231 20:51215981-51216003 CCCGCAACATTGTAAGATTTCAA No data
Right 1174531236 20:51216009-51216031 AAAAGAAATCTTTTATTTTGGGG No data
1174531231_1174531235 4 Left 1174531231 20:51215981-51216003 CCCGCAACATTGTAAGATTTCAA No data
Right 1174531235 20:51216008-51216030 GAAAAGAAATCTTTTATTTTGGG No data
1174531231_1174531237 14 Left 1174531231 20:51215981-51216003 CCCGCAACATTGTAAGATTTCAA No data
Right 1174531237 20:51216018-51216040 CTTTTATTTTGGGGCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174531231 Original CRISPR TTGAAATCTTACAATGTTGC GGG (reversed) Intergenic
No off target data available for this crispr