ID: 1174531232

View in Genome Browser
Species Human (GRCh38)
Location 20:51215982-51216004
Sequence TTTGAAATCTTACAATGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174531232_1174531235 3 Left 1174531232 20:51215982-51216004 CCGCAACATTGTAAGATTTCAAA No data
Right 1174531235 20:51216008-51216030 GAAAAGAAATCTTTTATTTTGGG No data
1174531232_1174531237 13 Left 1174531232 20:51215982-51216004 CCGCAACATTGTAAGATTTCAAA No data
Right 1174531237 20:51216018-51216040 CTTTTATTTTGGGGCCTCAAAGG No data
1174531232_1174531238 19 Left 1174531232 20:51215982-51216004 CCGCAACATTGTAAGATTTCAAA No data
Right 1174531238 20:51216024-51216046 TTTTGGGGCCTCAAAGGTCTAGG No data
1174531232_1174531234 2 Left 1174531232 20:51215982-51216004 CCGCAACATTGTAAGATTTCAAA No data
Right 1174531234 20:51216007-51216029 GGAAAAGAAATCTTTTATTTTGG No data
1174531232_1174531236 4 Left 1174531232 20:51215982-51216004 CCGCAACATTGTAAGATTTCAAA No data
Right 1174531236 20:51216009-51216031 AAAAGAAATCTTTTATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174531232 Original CRISPR TTTGAAATCTTACAATGTTG CGG (reversed) Intergenic
No off target data available for this crispr