ID: 1174531237

View in Genome Browser
Species Human (GRCh38)
Location 20:51216018-51216040
Sequence CTTTTATTTTGGGGCCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174531231_1174531237 14 Left 1174531231 20:51215981-51216003 CCCGCAACATTGTAAGATTTCAA No data
Right 1174531237 20:51216018-51216040 CTTTTATTTTGGGGCCTCAAAGG No data
1174531232_1174531237 13 Left 1174531232 20:51215982-51216004 CCGCAACATTGTAAGATTTCAAA No data
Right 1174531237 20:51216018-51216040 CTTTTATTTTGGGGCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174531237 Original CRISPR CTTTTATTTTGGGGCCTCAA AGG Intergenic
No off target data available for this crispr