ID: 1174533988

View in Genome Browser
Species Human (GRCh38)
Location 20:51236928-51236950
Sequence AGAGTGACCCTGCAAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174533988_1174533996 10 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533996 20:51236961-51236983 AGGTGAGGACAGGAGGACTGGGG No data
1174533988_1174533992 0 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533992 20:51236951-51236973 GGCTGTACGAAGGTGAGGACAGG No data
1174533988_1174533993 3 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533993 20:51236954-51236976 TGTACGAAGGTGAGGACAGGAGG No data
1174533988_1174533991 -5 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533991 20:51236946-51236968 ACTCTGGCTGTACGAAGGTGAGG No data
1174533988_1174533998 20 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533998 20:51236971-51236993 AGGAGGACTGGGGAAGAGGAAGG No data
1174533988_1174533994 8 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533994 20:51236959-51236981 GAAGGTGAGGACAGGAGGACTGG No data
1174533988_1174533990 -10 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533990 20:51236941-51236963 GGGTCACTCTGGCTGTACGAAGG No data
1174533988_1174533995 9 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533995 20:51236960-51236982 AAGGTGAGGACAGGAGGACTGGG No data
1174533988_1174533997 16 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533997 20:51236967-51236989 GGACAGGAGGACTGGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174533988 Original CRISPR AGAGTGACCCTGCAAATTGC AGG (reversed) Intergenic
No off target data available for this crispr