ID: 1174533997

View in Genome Browser
Species Human (GRCh38)
Location 20:51236967-51236989
Sequence GGACAGGAGGACTGGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174533986_1174533997 22 Left 1174533986 20:51236922-51236944 CCTGACCCTGCAATTTGCAGGGT No data
Right 1174533997 20:51236967-51236989 GGACAGGAGGACTGGGGAAGAGG No data
1174533988_1174533997 16 Left 1174533988 20:51236928-51236950 CCTGCAATTTGCAGGGTCACTCT No data
Right 1174533997 20:51236967-51236989 GGACAGGAGGACTGGGGAAGAGG No data
1174533987_1174533997 17 Left 1174533987 20:51236927-51236949 CCCTGCAATTTGCAGGGTCACTC No data
Right 1174533997 20:51236967-51236989 GGACAGGAGGACTGGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174533997 Original CRISPR GGACAGGAGGACTGGGGAAG AGG Intergenic
No off target data available for this crispr