ID: 1174537845

View in Genome Browser
Species Human (GRCh38)
Location 20:51266433-51266455
Sequence AGGTATTTACTGAGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174537838_1174537845 -7 Left 1174537838 20:51266417-51266439 CCCACCCATTAGAGGGAGGTATT No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537824_1174537845 23 Left 1174537824 20:51266387-51266409 CCCCAAACCTACCCTTGTCCAAC No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537826_1174537845 21 Left 1174537826 20:51266389-51266411 CCAAACCTACCCTTGTCCAACCC No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537837_1174537845 -6 Left 1174537837 20:51266416-51266438 CCCCACCCATTAGAGGGAGGTAT No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537831_1174537845 1 Left 1174537831 20:51266409-51266431 CCCTAGCCCCCACCCATTAGAGG No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537833_1174537845 0 Left 1174537833 20:51266410-51266432 CCTAGCCCCCACCCATTAGAGGG No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537829_1174537845 11 Left 1174537829 20:51266399-51266421 CCTTGTCCAACCCTAGCCCCCAC No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537839_1174537845 -8 Left 1174537839 20:51266418-51266440 CCACCCATTAGAGGGAGGTATTT No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537836_1174537845 -5 Left 1174537836 20:51266415-51266437 CCCCCACCCATTAGAGGGAGGTA No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537828_1174537845 12 Left 1174537828 20:51266398-51266420 CCCTTGTCCAACCCTAGCCCCCA No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537830_1174537845 5 Left 1174537830 20:51266405-51266427 CCAACCCTAGCCCCCACCCATTA No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537825_1174537845 22 Left 1174537825 20:51266388-51266410 CCCAAACCTACCCTTGTCCAACC No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537823_1174537845 24 Left 1174537823 20:51266386-51266408 CCCCCAAACCTACCCTTGTCCAA No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data
1174537827_1174537845 16 Left 1174537827 20:51266394-51266416 CCTACCCTTGTCCAACCCTAGCC No data
Right 1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174537845 Original CRISPR AGGTATTTACTGAGGGAATA GGG Intergenic
No off target data available for this crispr