ID: 1174541092

View in Genome Browser
Species Human (GRCh38)
Location 20:51290047-51290069
Sequence CTAATGATGCACCCCGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174541092_1174541100 6 Left 1174541092 20:51290047-51290069 CCCACACCGGGGTGCATCATTAG No data
Right 1174541100 20:51290076-51290098 AGGTTCAAGGCAGCAGTGACAGG No data
1174541092_1174541096 -7 Left 1174541092 20:51290047-51290069 CCCACACCGGGGTGCATCATTAG No data
Right 1174541096 20:51290063-51290085 TCATTAGCCCTCCAGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174541092 Original CRISPR CTAATGATGCACCCCGGTGT GGG (reversed) Intergenic
No off target data available for this crispr