ID: 1174541096

View in Genome Browser
Species Human (GRCh38)
Location 20:51290063-51290085
Sequence TCATTAGCCCTCCAGGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174541088_1174541096 30 Left 1174541088 20:51290010-51290032 CCAGGTGAGAGGAGATGGAGGCT No data
Right 1174541096 20:51290063-51290085 TCATTAGCCCTCCAGGTTCAAGG No data
1174541093_1174541096 -8 Left 1174541093 20:51290048-51290070 CCACACCGGGGTGCATCATTAGC No data
Right 1174541096 20:51290063-51290085 TCATTAGCCCTCCAGGTTCAAGG No data
1174541092_1174541096 -7 Left 1174541092 20:51290047-51290069 CCCACACCGGGGTGCATCATTAG No data
Right 1174541096 20:51290063-51290085 TCATTAGCCCTCCAGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174541096 Original CRISPR TCATTAGCCCTCCAGGTTCA AGG Intergenic