ID: 1174542226

View in Genome Browser
Species Human (GRCh38)
Location 20:51298570-51298592
Sequence ATCTCTCTCCGCCCTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174542226_1174542229 -4 Left 1174542226 20:51298570-51298592 CCAGCACCAGGGCGGAGAGAGAT No data
Right 1174542229 20:51298589-51298611 AGATCTTGGTTAGTATTCCTAGG No data
1174542226_1174542230 0 Left 1174542226 20:51298570-51298592 CCAGCACCAGGGCGGAGAGAGAT No data
Right 1174542230 20:51298593-51298615 CTTGGTTAGTATTCCTAGGATGG No data
1174542226_1174542231 8 Left 1174542226 20:51298570-51298592 CCAGCACCAGGGCGGAGAGAGAT No data
Right 1174542231 20:51298601-51298623 GTATTCCTAGGATGGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174542226 Original CRISPR ATCTCTCTCCGCCCTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr