ID: 1174547860

View in Genome Browser
Species Human (GRCh38)
Location 20:51339454-51339476
Sequence CACTCTTTCTAGATGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174547854_1174547860 29 Left 1174547854 20:51339402-51339424 CCATAAGGCCTAGAAGGATATGG No data
Right 1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG No data
1174547853_1174547860 30 Left 1174547853 20:51339401-51339423 CCCATAAGGCCTAGAAGGATATG No data
Right 1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG No data
1174547856_1174547860 21 Left 1174547856 20:51339410-51339432 CCTAGAAGGATATGGTTCTCAAT No data
Right 1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG No data
1174547857_1174547860 -7 Left 1174547857 20:51339438-51339460 CCTCTTAAGAAGACCTCACTCTT No data
Right 1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174547860 Original CRISPR CACTCTTTCTAGATGGCACA AGG Intergenic
No off target data available for this crispr